Research Article Volume 9 Issue 4
1Department of Veterinary Public Health and Preventive Medicine, University of Ibadan, Nigeria
2School for Global Animal Health, Washington State University, Nigeria
3Department of Veterinary Medicine, University of Jos, Nigeria
4Department of Veterinary Parasitology and entemology, University of Ibadan, Nigeria
Correspondence: Olatoye IO, Department of Veterinary Public Health and Preventive Medicine, Ibadan, University of Ibadan, Nigeria
Received: May 20, 2019 | Published: July 28, 2020
Citation: Olufemi AS, Olatoye IO, Oladele DO, et al. Morphometric and molecular identification of Eimeria species from commercial chickens in Nigeria. J Dairy Vet Anim Res. 2020;9(4):104-108. DOI: 10.15406/jdvar.2020.09.00288
Eimeria species are important coccidian parasites causing significant economic losses from clinical and subclinical coccidiosis in poultry worldwide. The objective of this study was to identify the abundance of Eimeria species responsible for coccidial infections in commercial chicken flocks in Nigeria. Morphometric methods by oocyt sedimentation and microscopy were used to identify Eimeria species from pooled faecal samples randomly obtained from commercial chicken farms. While Real-Time quantitative Polymerase Chain Reaction (RT-qPCR) targeting the Sequence Characterized Amplified Region (SCAR) from the genomic DNA extracted from the faecal samples was used to determine the specific species of Eimeria.
Morphometry identification resulted in threegroups of oocyst category Eimeria based on the length were identified (BM group: E. brunetti and E. maxima;AM group: E. acervulina and E. mitis and NTP group: E. necatrix, E. tenella and E. praecox). The relative abundance of 3.0%, 52.0% and 45.0% were obtained for BM group, AM group and NTP group respectively. Molecular method detected Five Eimeria species were identified by real-time qPCR from the samples with species-specific relative abundance of 37.8%, 1.1%, 7.1%, 3.1% and 50.9% E. acervulina, E. maxima, E. necatrix, E. tenella and E. mitis; while E. praecox and E. brunetti were not detected. All markers utilized in these qPCR assays were absolutely species-specific and support reproducible quantification across a wide linear range, unaffected by the presence of non-target species or other contaminating DNA. The sensitivity of this assay indicated that DNA equivalent to a single sporulated oocyst can be consistently detected.
Only five out of the conventional pathogenic species of Eimeria were detected in commercial chickens sampled in Nigeria. The epizootiological significance of the identified circulating Eimeria species is to enhance coccidiosis vaccination prophylaxis in Nigeria.
Keywords: morphometry, molecular, coccidiosis, Eimeria, chicken
Coccidiosis is one of the most economically devastating diseases of domestic poultry caused by protozoan parasites of genus Eimeria. Domestic fowls are infected by seven distinct Eimeria species which are usually both site and host-specific resulting in enteric diseases of a variable degree of severity1 are recognized namely Eimeria brunetti, E. maxima, E. necatrix, E. tenella, E. acervulina, E. mitis, and E. praecox.2
However, the existence of Eimeria hagani and Eimeria mivati has been questioned by many researchers.3,4 These two species are also overlooked in papers that deal with species discrimination techniques.4,5 Vrba et al.,6 reported that Eimeria mivati is a variant of Eimeria mitis and not distinct specie. The authenticity of E. hagani is still doubtful. For morphometric identification, Eimeria species was categorized according to oocysts size, into three groups namely: AM group (small oocysts, <18.8μm tentatively E. acervulina and E. mitis), an NTP group (medium-sized oocysts 18.9μm to 23.8μm tentatively E. necatrix, E. tenella and E. praecox), or a BM group (large oocysts, >23.9μm, tentatively E. maxima and E. Brunetti).7
Eimeria species cannot be precisely distinguished by simply using oocyst morphology. There are specie specific molecular methods that are used to achieve precise identification of Eimeria species. Classical non-quantitative PCR methods for molecular diagnosis of the seven Eimeria species that infect chickens have been developed using targets including internal transcribed spacer or ITS-1sequences8,9 or sequence characterized amplified regions – SCARs.10 Diagnosis can be complicated in chickens with mixed specie infections and polymorphism within the target region can affect the sensitivity of the PCR.5 Real-Time Quantitative PCR is capable of identifying, differentiating among and quantifying the Eimeria species present in chickens even with mixed-species infections. It is more sensitive than conventional PCR because while Real-Time PCR can detect as little as two-fold amplification, Agarose gel resolution required about 10 folds.5
Sampling
The study was conducted on commercial chicken flocks in Nigeria. Fresh faecal samples were collected from minimum of six different spots in the poultry pens. The faeces were homogenized and a representative sample of 100g was transported to the laboratory with ice packs for processing.
Laboratory processing
The homogenized faecal suspension was passed through a sieve (50 microns) and nylon tissue to exclude helminth eggs. The supernatant was decanted and the sediment was centrifuged at 4000 x g for 10 minutes. The sediment was re-suspended in saturated sucrose solution (containing 685 g sucrose per liter of solution). It was then centrifuged at 1500 x g for 30 minutes to concentrate the oocysts. The collected supernatant was subsequently diluted up to 5 times with distilled water, shaken vigorously and centrifuged at 4000 x g for 10 minutes. The supernatant was decanted and the Eimeria oocysts present in the sediment were preserved in 2.5% Potassium dichromate.
Identification of Eimeria species
The oocysts enumerated above (both sporulated and unsporulated) were identified by morphometry carried out by measurement of 50 oocysts using calibrated ocular micrometer at 400x magnification according to Long and Reid.11 They were categorized in accordance with Haug et al.,7 into three groups: Acervulina-Mitis (AM) group (small oocysts, <18.8μm; tentatively Eimeria acervulina and/or Eimeria mitis); Necatrix, Tenella & Praecox (NTP) group (medium-sized oocysts, 18.9 μm to 23.8 μm; tentatively Eimeria necatrix, Eimeria tenella and/or Eimeria praecox) or a Brunetti-Maxima (BM) group (large ovoid oocysts, >23.9μm; tentatively Eimeria brunetti and/or Eimeria maxima).
Extraction of DNA from Eimeria Oocysts
One μl of the pooled oocyst sample was washed with an equal volume of Phosphate Buffer Saline (PBS) in a 2 ml Eppendorf tubes three times by centrifuging at 13,000 g for 1 minute in order to remove the potassium dichromate used in preserving the oocysts. The resulting pellet was re-suspended in 100 μl of PBS. It was transferred into a screw cap tube with 0.5μg of glass bead added and vortexed for 3 minutes to break the resilient oocyst walls in order to extract the DNA from the sporozoites. A drop of the sample was examined under the microscope to confirm disruption of the oocyst wall under x40 objective. After confirmation of the disruption of the oocyst wall, 200μl of ATL from Qiagen DNeasy blood and tissue kit was added and vortexed briefly. After this, 20μl proteinase K was added to the mixture and vortexed. It was incubated at 560C for 30 minutes to enable efficient tissue lysis. The lysate was put in a new tube and 200μl of AL buffer was added and vortexed. Also, 200μl of ethanol was added to the sample and vortexed. The resulting suspension was transferred into a DNeasy column and centrifuged at 13,000 g for 1 minute. The flow-through was discarded and the spin column put inside a new 2ml collection tube. It was then washed with 500μl AW1 and spin at 13,000 g for 1 minute. The flow-through was was also discarded and the spin column put inside another new 2 ml collection tube. This was washed with 500μl AW2 and spin at 13000 g for 3 minutes to dry the DNeasy membrane of residual ethanol so as not to interfere with subsequent reactions. It was then eluted with 100μl AE buffer into clean 2 ml micro centrifuge tubes and centrifuge for 1 minute at 8000 g. The flow-through contained the genomic DNA samples of the oocysts and stored in a refrigerator for preservation.
Quantitative real-time polymerase chain reaction technique
The DNA sample was removed from the fridge and 1μl was taken by pipette into a well in the 96 plate qPCR plate in triplicates. 1 mL of the positive and negative controls was put in the 11th and 12th column respectively. The following were measured, vortexed and mixed together in a 2ml qPCR tube (A): 500μl master mix containing 150mM Tris-Hcl, 40mM (NH4)2 SO4, 0.02% Tween 20, 5mM MgCl2, 400μM d ATP, 400μM d CTP, 400μM d GTP, 400μM d TTP and 50μ/mL Taq DNA polymerase; 297μl qPCR water and 3μl ROX dye. It was briefly vortexed after mixing. Into another 2ml qPCR tube (B) was measured the following after being vortexed initially: 10μl of Primer, 5μl of the probe and 175μl of nuclease free water and vortexed again. Subsequently 8μL from the mixture in A and 1μL of B was added to all the rows and columns of the qPCR plate. Table 1 shows the panel of primers and probe sequences used.
Species |
Sequence source (SCARdb ID) |
Primer and probe sequences |
Amplicon size [bp] |
||
E. acervulina |
Ac-AD18-953 |
ACE-F: GCAGTCCGATGAAAGGTATTTG; |
103 |
||
E. brunetti |
Br-J18-626 |
BRU-F: AGCGTGTAATCTGCTTTTGGAA; |
118 |
||
E. maxima |
EmMIC1 |
MAX-F: TCGTTGCATTCGACAGATTC; |
138 |
||
E. mitis |
Mt-A09-716 |
MIT-F: CAAGGGGATGCATGGAATATAA; |
115 |
||
E. necatrix |
Nc-AD10-702 |
NEC-F: AACGCCGGTATGCCTCGTCG; |
134 |
||
E. praecox |
Pr-A09-1108 |
PRA-F: CACATCCAATGCGATATAGGG; |
117 |
||
E. tenella |
Tn-E03-1161 |
TEN-F: TCGTCTTTGGCTGGCTATTC; |
100 |
Table 1 qPCR primer panel of and probe sequences specific for the seven chicken Eimeria species
The qPCR plate was covered with the optical cover provided and pressed down without allowing finger print impression marks on it. The plate was centrifuged briefly for a few seconds to allow a proper settlement of the constituents in the wells of the qPCR plates. The thermocycler was already put on to warm it up to the required temperature of 950C. The qPCR plate was put inside the thermo-cycler. The thermal cycling program used was initial denaturation at 950C for 1 minute followed by 40 cycles of denaturation at 950C for 15 seconds and combined annealing and extension at 600C for 30 seconds.
Fluorescence data were collected at the end of each cycle. Each sample was run in triplicate. The result was then analysed on the computer after the end of the cycling period. The quantitative real-time PCR reactions were performed in a Stratagene Mx3005P® real-time qPCR cycler. Both positive and negative template controls were included. The resulting data were processed using Mx ProTM software (Stratagene, USA). Threshold cycles (Ct) were calculated from baseline-corrected normalized fluorescence (dRn) data (Figure 1).
Morphometric of Eimeria species
The NTP group made up of medium sized oocysts of E. necatrix, E. tenella and E. praecox has a relative abundance of 52%. This was followed by the small sized oocysts of the AM group comprising of E. acervulina and E. mitis with a relative abundance of 45% while the big sized oocysts of the BM group comprising of E. brunetti and E. maxima was only 3%.
Molecular results of Eimeria species
The results qPCR of the pooled samples are shown in table 2. Only five Eimeria species namely: E. acervulina, E. tenella, E. mitis, E. necatrix and E. maxima were detected. Eimeria brunetti and E. praecox were not detected in the samples. E. mitis has the highest abundance at 50.9% followed by E. acervulina at 37.8%. Others were E. necatrix, 7.1%, E. tenella, 3.1% and E. maxima 1.1%. The first four are known to be pathogenic while E. mitis although less pathogenic. The primers were sufficiently sensitive and specie specific to enable the discrimination of the seven Eimeria species of chicken. The qPCR used in this study was fully quantitative and removed the requirement for gel electrophoresis. This method was able to measure the precise gene copy numbers by comparison with a standard curve as well as the Ct values between the samples.
Species |
qPCR Ct Cycle |
Abundance |
E. acervulina |
29.45 |
37.83% |
E. mitis |
31.2 |
50.91% |
E. brunetti |
No Ct |
Not detected |
E. maxima |
36.97 |
1.06% |
E. necatrix |
34.16 |
7.10% |
E. tenella |
33.07 |
3.11% |
E. praecox |
No Ct |
Not detected |
Table 2 Real-time quantitative polymerase chain reaction (qPCR) results for the seven (7) Eimeria species of poultry in pooled fecal samples taken from commercial chicken farms in Nigeria
The identification of Eimeria species based on traditional morphometric method has been the gold standard in Nigeria until the introduction of molecular diagnostic method which is yet to be fully embraced. Both the morphometric and molecular methods indicated a low relative abundance of the BM group of 3% and 1.1% respectively. Their low abundance in the environment may either due to the efficacy of control measures or their innate inability to flourish under the existing environmental conditions. The real-time qPCR detected E. maxima but not E. brunetti. The morphometric method indicated an abundance of 45% for the AM group while the real-time qPCR reported 88.7% made up of 50.9% for E. mitis and 37.8% for E. acervulina. Similarly, morphometry method indicated an abundance of 52% for the TNP group while the real-time qPCR indicated 10.2% abundance made up of 7.1% for E. necatrix and 3.1% for E. tenella. E. praecox was not detected. The huge disparity in the figures reported for the morphometric and molecular methods is probably an indication that some Eimeria species were either undetected or wrongly categorized due essentially to the differences in the specificity and sensitivity of the two different techniques. Majaro,12 reported that oocyst size and shapes do vary as the duration and severity of infection increases and this might be partly contributory to the observed disparities. It has also been reported that the measurements of the oocysts undergo variations due to changes in metabolism of parasites or birds, and even in the value of the shape morphometric indices that may overlap and lead to misleading conclusions regarding the species.13 Jatau et al.,14 reported that comparison of microscopic observation of oocysts with PCR-based detection of Eimeria genomic DNA yielded variable results. The identification of five Eimeria species in this study namely E. acervulina, E. tenella, E. necatrix, E. mitis and E. maxima is in agreement with those reported by other researchers 15,16,17 who also reported the five species without E. praecox and E. brunetti. Ogedengbe et al.,18 using a sequenced characterized multiplex PCR method reported the characterization of 4 Eimeria species from samples taken from Nigeria, namely; Eimeria tenella, E. acervulina, E. mitis and E. brunetti. This perhaps should have confirmed the presence of E. brunetti in Nigeria but the 2 samples labelled D6 subjected to Agar gel electrophoresis gave conflicting results. One indicated the presence of E. brunetti and E. tenella while the other indicated E. tenella and E acervulina. Moreover, none of the other 8 samples from Nigeria contained E. brunetti. Further works in this area is needed to fully elucidate the identity of circulating Eimeria species in different parts of Nigeria. The result of the present study probably represents an improvement over the molecular identification of the Eimeria species in Nigeria carried out by Jatau and Ojimelukwe et al.15,19 which reported only four of the seven Eimeria species each namely E. acervulina, E tenella, E. necatrix, and E mitis but not E. maxima. The non detection of E. maxima in those two earlier molecular studies was probably due to the very low relative abundance of E. maxima (about 1.1% in the present study) and the lower sensitivity of the conventional PCR used in those studies as against the real-time qPCR (used for the present study) which can consistently detect DNA equivalent to a single sporulated oocyst as against the Agarose gel resolution that required about 10 folds.5 This is probably the first real-time qPCR study to confirm the presence of circulating Eimeria maxima in Nigeria.
The present result is at variance with those of Carvalho et al.,20 Sun et al.,13 and Al-Natour et al.,21 who all reported the presence of the seven Eimeria species. Although Schwarz et al.23 reported six Eimeria species; E. brunetti and E. praecox were present. The non-detection of E. brunetti in this study contradicted the assertion of Majaro13 that the species of Eimeria causing coccidial infection in Nigeria were E. tenella, E. necatrix, E. brunetti and E. acervulina. However, the unreliability of morphological Eimeria species identification used in those studies could be responsible for this. Precise identification and genetic characterisation of different species of Eimeria are central to surveillance, prevention and control of coccidial infection.23 The development of molecular tools has allowed not only the diagnosis but also the study on genetic variability of pathogens based on small quantities of oocysts through molecular markers.8,23
Five species of Eimeria identified and confirmed in this study provide useful epizootiological information on chicken coccodiosis in Nigeria. This will help in discrimination and selection of a cost effective and efficacious anti coccidial vaccine for use in the area. The preliminary data generated could serve as a template for future baseline epizootiological studies leading to better and more effective treatment, control and preventive strategies in the area.
The authors would like to thank the Management and staff Biopharm Research Institute of Biopharmacy and Veterinary Drugs, Prague Czech Republic for providing the training, materials, and equipments used for this study.
We hereby declare that there is no conflict of interest.
©2020 Olufemi, et al. This is an open access article distributed under the terms of the, which permits unrestricted use, distribution, and build upon your work non-commercially.