International Journal of
eISSN: 2470-9980
Submit manuscript...
Short Communication Volume 5 Issue 1
The Problem of Il2 in Echinodermata
Michel Leclerc
Verify Captcha
Regret for the inconvenience: we are taking measures to prevent fraudulent form submissions by extractors and page crawlers. Please type the correct Captcha word to see email ID.
Verify Captcha
Regret for the inconvenience: we are taking measures to prevent fraudulent form submissions by extractors and page crawlers. Please type the correct Captcha word to see email ID.
Immunology of Invertebrates University of Orleans, France
Correspondence: Michel Leclerc, Immunology of Invertebrates University of Orleans, 556 rue Isabelle Romée, 45640 Sandillon, France, Tel 02 38 41 02 09
Received: January 19, 2018 | Published: February 16, 2018
Citation: Leclerc M (2018) The Problem of Il2 in Echinodermata. Int J Vaccines Vaccin 5(1): 00095. DOI: 10.15406/ijvv.2018.05.00095
Abstract
The IL2 gene was at last discovered in an Invertebrate: the ophuirid Ophiocomina nigra (Echinodermata). Many genomic researches in sea star Asterias rubens (another Echinodermata) were unsuccessful even if Flow cytometry indicated positive results. It’s the first time that such an interleukin gene appears in invertebrates.
Keywords:echinodermata, ophuirids, asteroids, genome, il2
Introduction
In a general way, IL2 interleukin is linked to T vertebrate lymphocytes. On the other hand an IL2 activity was demonstrated in sea star (Echinodermata)1,2 but was not found in sea star genome in a significant manner (because of the weakness of the e-value). Recently after hard research it was discovered in the first sister of the sea star Asterias rubens: the ophuirid: Ophiocomina nigra. The aim of this paper consists in presenting the IL2 sequence in the ophuirid genome we just studied.
Material and methods
Animals were obtained from the Biologic Station Marine of Roscoff (France). Digestive coeca were excised from their body and Ophiocomina nigra mRNA was realized by the mean of Uptizol kit (Interchim) after purification.
Sequencing was operated on Illumina Next 500 with paired-end: 2.75 bp. Quality controls were operated.
Transcriptome was assembled from RNA-Seq fastq files using Trinity v2.1.13 with default parameters. A BLAST database was created with the assembled transcripts using makeblastdb application from ncbi-blast+ (v2.2.31+). The sequences of transcripts of interest were then blasted against this database using blastn application from ncbi-blast+
4 with parameter word_size 7.
Results
The sequence of Ophuirid IL2 comes now:
>NM_000586.3 Homo sapiens interleukin 2 (IL2), mRNA
5’AGTTCCCTATCACTCTCTTTAATCACTACTCACAGTAACCTCAACTCCTGCCACAATGTACAGGATGCAA
CTCCTGTCTTGCATTGCACTAAGTCTTGCACTTGTCACAAACAGTGCACCTACTTCAAGTTCTACAAAGA
AAACACAGCTACAACTGGAGCATTTACTGCTGGATTTACAGATGATTTTGAATGGAATTAATAATTACAA
GAATCCCAAACTCACCAGGATGCTCACATTTAAGTTTTACATGCCCAAGAAGGCCACAGAACTGAAACAT
CTTCAGTGTCTAGAAGAAGAACTCAAACCTCTGGAGGAAGTGCTAAATTTAGCTCAAAGCAAAAACTTTC
ACTTAAGACCCAGGGACTTAATCAGCAATATCAACGTAATAGTTCTGGAACTAAAGGGATCTGAAACAAC
ATTCATGTGTGAATATGCTGATGAGACAGCAACCATTGTAGAATTTCTGAACAGATGGATTACCTTTTGT
CAAAGCATCATCTCAACACTGACTTGATAATTAAGTGCTTCCCACTTAAAACATATCAGGCCTTCTATTT
ATTTAAATATTTAAATTTTATATTTATTGTTGAATGTATGGTTTGCTACCTATTGTAACTATTATTCTTA
ATCTTAAAACTATAAATATGGATCTTTTATGATTCTTTTTGTAAGCCCTAGGGGCTCTAAAATGGTTTCA
CTTATTTATCCCAAAATATTTATTATTATGTTGAATGTTAAATATAGTATCTATGTAGATTGGTTAGTAA
AACTATTTAATAAATTTGATAAATATAAAAAAAAAAAAAAAAAAAAAAAAAA3’ (Table 1).
Query ID |
Query Gene Name |
Subject ID |
Identity (%) |
Length Allignment |
Mismatch |
Gapopen |
E-Value |
Bitscore |
NM_000586.3 |
IL2 |
TRINITY_DN228128_c0_g1_i1 |
94.74 |
38 |
2 |
0 |
1,00E-08 |
60,2 |
Table 1 The sequence of Ophuirid IL2
Discussion & Conclusion
The main acquisition of Echinodermata, especially asterids and perhaps ophuirids, seems to be cellular differentiation into two subpopulations, ancestral to B and T vertebrate lymphocytes. These cells interplay with macrophage-like cells, resulting in the synthesis of primitive antibody complement-dependent.5
As for IL2, genomic studies in ophuirids show clearly its existence with an excellent e-value. Thus, another acquisition in Echinodermata consists in the appearance of a panel of interleukins in ophuirids and certainly in asterids: IL1, IL2, IL4, IL6 which play a role in the regulation of the immune system of these invertebrates. We hope that the present paper will help in suggesting provocative ideas on adaptative and innate immunity in invertebrates.
Acknowledgments
None.
Conflicts of interest
Author declares there are no conflicts of interest.
Funding
None.
References
- Leclerc M, Brillouet C, Luquet G, et al. Properties of Cell Subpopulations of Starfish Axial Organ: In Vitro Effect of Pokeweed Mitogen and Evidence of Lymphokine-like Substances. Scand J Immunol. 1981;14(3):281‒284.
- Legac E, Vaugier GL, Bousquet F, et al. Primitive Cytokines and Cytokine Receptors in Invertebrates: the Sea Star Asterias rubens as a Model of Study. Scand J Immunol. 1996;44(4):375‒380.
- Grabherr MG, Brian HJ, Yassour M, et al. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nature Biotechnology . 2011;29:644‒652.
- Altschul SF, Warren G, Webb M, et al. Basic local alignment search tool. J Mol Biol. 1990;215(3):403‒410.
- Leclerc M. J Cell Sci Ther. 2014;5:175.
©2018 Leclerc. This is an open access article distributed under the terms of the, which permits unrestricted use, distribution, and build upon your work non-commercially.