Submit manuscript...
Journal of
eISSN: 2373-437X

Microbiology & Experimentation

Preliminary Report Volume 7 Issue 1

Nasal colonization of SCCmec II, III and tst-1 positive Methiticillin resistance Staphylococcal aureus isolated from patients in a hemodialysis unit, Tehran, Iran

Zohreh Aminzadeh,1 Atefeh Akhavi Mirab,1 Mehdi Goudarzi,2 Narges sadat Zahed3

1Infectious Disease and Tropical Medicine Research Center, Shahid Beheshti University of Medical Sciences, Iran
2Department of Microbiology, School of Medicine, Shahid Beheshti University of Medical Sciences, Iran
3Department of Nephrology, Shahid Beheshti University of Medical Sciences, Iran

Correspondence: Zohreh Aminzadeh, Infectious Disease and Tropical Medicine Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran

Received: January 25, 2019 | Published: February 26, 2019

Citation: Aminzadeh Z, Mirab AA, Goudarzi M, et al. Nasal colonization of SCCmec II, III and tst-1 positive Methiticillin resistance Staphylococcal aureus isolated from patients in a hemodialysis unit, Tehran, Iran. J Microbiol Exp. 2019;7(1):56-58. DOI: 10.15406/jmen.2019.07.00241

Download PDF

Abstract

Patients with end-stage renal disease undergoing dialysis are at the high risk of infections or colonization with MRSA. We evaluated the status colonization of two hemodialysis patients and determined their phenotype by using oxacillin and cefoxitin disks and also studied their genotypes by using PCR. We found the MRSA strains in our cases were healthcare associated harboring SCCmec II & III and tst or PVL gene positive. This report emphasizes the importance of S.aureus status colonization in this group due to MSSA and MRSA isolates can harbor the mobile genetic element of tst gene and also the acquisition of the SCCmec for changing MSSA to MRSA is possible.

Keywords: Staphylococcus aureus, Hemodialysis, SCCmec, mecA, tst gene, PVL, exfoliative gene

Introduction

Infections due to Staphylococcus aureus account for a major cause of morbidity and mortality in hemodialysis patients.1,2 Colonization of S.aureus is associated with a four-fold higher risk of bloodstream infection. Hemodialysis patients suffer from a high rate of infection or colonization with MRSA which lead to increased rate of mortality, length of hospital stay, and healthcare costs compared to those infected with methicillin-susceptible S. aureus.3,4 Methicillin susceptible S.aureus changes to MRSA by acquisition of staphylococcal Cassette Chromosome mec (SCCmec) a genomic island that encodes methicillin resistance.5 The tst gene, a mobile genetic element, encodes Toxic shock syndrome toxin 1 (TSST-1) a super- antigenic toxin secreted by both MRSA and MSSA.6 Besides, Panton-Valentine leukocidin is a gamma-toxin mostly produced by CA-MRSA.7 The aim was to determine the presence of mecA, lukS/lukF-PV (PVL), eta & etb genes (exfoliative toxin A & B) and tst genes (TSST-1) in two S.aureus colonized patients.

Material and methods

Following our previous research regarding nasal carriage of S.aureus in hemodialysis units,8 we re-evaluated two of those patients who were colonized with MRSA in the last time and at the time of re-evaluation in order to determine the presence of mecA, lukS/lukF-PV (PVL), eta & etb genes (exfoliative toxin A & B) and tst genes (TSST-1) by PCR. All mecA-positive isolates were classified to staphylococcal cassette chromosome mec (SCCmec) types by multiplex PCR.

Bacterial strains

The nasal samples of patients were cultured in blood agar and mannitol salt agar medium, and identification of S. aureus was done using Gram staining and conventional biochemical tests.9 Finally, the isolates were stored in tryptic soy broth containing 15% glycerol, and stored at -70°C until future processing. 

Phenotypic determination of MRSA

The disk diffusion method was used for the phenotypic detection of MRSA. The oxacillin (OX) and cefoxitin (FOX) discs on Mueller-Hinton agar plates containing 4% NaCl were used. A zone of inhibition of < 21mm for oxacillin and <13mm for cefoxitin were considered MRSA (10). Staphylococcus aureus ATCC700698 was used as the positive control for MRSA strains.11

DNA extraction and polymerase chain reaction

Genomic DNA of MRSA strains were extracted using the commercial kit InstaGene Matrix (BioRad; USA) with the addition of lysostaphin (Sigma–Aldrich; USA) to a final concentration of 15μg/ml. Then, the concentration of DNA was assessed using a spectrophotometer. Genomic DNA was extracted using a commercially available DNA extraction kit (QiaAmp DNA Mini Kit) based on the manufacturer’s instructions. For confirmation of MRSA, the mecA gene was detected by PCR with the specific primers listed in the Table.12 Staphylococcus aureus ATCC700698 was used as the positive control for mecA gene detection.11

SCCmec typing

SCCmec typing was performed for all MRSA isolates by multiplex PCR. Primer sequences have been demonstrated in the Table 1.

Target

Primer

Primer sequence (5′ → 3′)

Product Size

Reference

Case1

Case2

mecA

 F

AGAAGATGGTATGTGGAAGTTAG

583

12

Positive

Positive

R

ATGTATGTGCGATTGTATTGC

luk-PV

F

TTCACTATTTGTAAAAGTGTCAGACCCACT

180

13

Negative

Positive

R

TACTAATGAATTTTTTTATCGTAAGCCCTT

tst-1

F

TTATCGTAAGCCCTTTGTTG

398

12

Positive

Negative

R

TAAAGGTAGTTCTATTGGAGTAGG

eta

F

GCAGGTGTTGATTTAGCATT

93

14

Negative

Negative

R

AGATGTCCCTATTTTTGCTG

etb

F

ACAAGCAAAAGAATACAGCG

226

14

Negative

Negative

R

GTTTTTGGCTGCTTCTCTTG

SCCmec

Fβ

ATTGCCTTGATAATAGCCYTCT

937

15

 

R α3

TAAAGGCATCAATGCACAAACACT

F ccrC

CGTCTATTACAAGATGTTAAGGATAAT

518

16

 

Positive

R ccrC

CCTTTATAGACTGGATTATTCAAAATAT

F 1272

GCCACTCATAACATATGGAA

415

15-17

Positive

 

R 1272

CATCCGAGTGAAACCCAAA

F 5RmecA

TATACCAAACCCGACAACTAC

359

16-17

   

R 5R431

CGGCTACAGTGATAACATCC

F

ATCATTAGGTAAAATGTCTGGACATGATCCA

433

13

   

R

GCATCAAGTGTATTGGATAGCAAAAGC

Table 1 The oligonucleotide primers and characteristic information, A hemodialysis unit, Tehran, Iran

SCCmec types were identified by comparing the banding patterns of MRSA to ATCC 10442 (SCCmec type I), N315 (SCCmec type II), 85/2082 (SCCmec type III), MW2 (SCCmec type IV), WIS (SCCmec type V) as reference strains.

Case 1

A 59- year old man was on maintenance hemodialysis for 1.2 year. He has used a fistula as his venous access and suffering from the co-morbidities of diabetes mellitus and hypertension. He did not have a history of admission, surgery, skin and soft tissue infections or taking antibiotics over the previous three months. His MRSA isolate harbored mecA gene, SCCmec type III and tst gene but was negative for exfoliative toxins (eta & etb) and PVL.

Case 2

 A 58year-old man was on maintenance hemodialysis for 2.5 years. He had a fistula as his venous access and was suffering from diabetes mellitus and heart failure. His past medical history included taking antibiotics over the previous three months with no hospitalization, surgery or skin and soft tissue infections. The isolated MRSA harbored PVL, mecA gene and SCCmec type II. The isolate was not producing exfoliative toxin A and B and TSST-1. The Table 1 shows the Oligonucleotide primers, and the characteristic information of our patients.

Discussion

The isolated MRSA of our patients harbored SCCmec II & III which as expected. The MRSA infections in hemodialysis patients were conventionally considered to be acquired from healthcare (HA), usually with strains harboring SCCmec types II/III.18 Moreover, both MRSA clones in our patients were in agreement with the geographic distribution and pattern of MRSA clones in Asian countries.19 Besides, one of our cases was colonized with MRSA harboring PVL and SCCmec II. In other research, many CA-MRSA isolates harbored PVL gene7 and CA-MRSA harboring SCCmec IV & V was associated with PVL gene carriage.20 Therefore, it seems our clone was HA-MRSA harboring PVL gene.

The MRSA isolated from the case 1 in present study harbored tst-1 gene. The tst gene was identified among MSSA and MRSA21,22 and also was detected in both CA-S.aureus and HA- S.aureus.23 The tst-positive strains usually spread silently in hospitals and do not always lead up to clinical symptoms.24 However, in an in-vitro study, one strain of MRSA which was isolated from a hemodialysis patient with the catheter-related infection could have expressed the tst gene.25 Besides, nasal colonization of healthcare workers with TSST-1 positive S.aureus was reported26 and MRSA harboring tst-1 gene was known as an endemic pathogen in the hospital.27 We think the isolated tst-positive MRSA in our patient was HA-MRSA.

The MRSA colonized in the case I had SCCmec III and tst gene. A higher mortality rate in patients with tst-1 positive or SCCmec II MRSA isolates was reported.28 It seems harboring tst gene in case of clinical symptoms would be associated with a poor prognosis. However, none of the tst-positive S.aureus strains was positive for PVL in previous reports29 that is similar to present report.

Conclusion

Because both MSSA and MRSA isolates can harbor the mobile genetic element of tst gene and also the acquisition of the SCCmec for changing MSSA to MRSA is possible, this study has emphasized that how important is to evaluate and detect the colonization status of hemodialysis patients for S.aureus regardless of the resistant pattern.

Acknowledgements

None.

Conflict of interest

Authors declare that there is no conflicts of interest.

References

  1. Nouwen JL, Fieren MW, Snijders S, et al. Persistent (not intermittent) nasal carriage of Staphylococcus aureus is the determinant of CPD-related infections. Kidney Int. 2005;67(3):1084‒1092.
  2. Worth LJ, Spelman T, Holt SG, et al. Epidemiology of infections and antimicrobial use in Australian haemodialysis outpatients: findings from a Victorian surveillance network, 2008-2015. J Hosp Infect. 2017;97(1):93‒98.
  3. Shinefield H, Black S, Fattom A, et al. Use of a Staphylococcus aureus conjugate vaccine in patients receiving hemodialysis. N Engl J Med. 2002;346(7):491‒496.
  4. Yu VL, Goetz A, Wagener M, et al. Staphylococcus aureus nasal carriage and infection in patients on hemodialysis. N Engl J Med. 1986;315(2):91‒96.
  5. Ito T, Kuwahara K, Hiramatsu K. Staphylococcal cassette chromosome mec (SCC mec) analysis of MRSA. Methods Mol Biol. 2014;1085:131‒148.
  6. Novick RP. Mobile genetic elements and bacterial toxinoses: the superantigen-encoding pathogenicity islands of Staphylococcus aureus. Plasmid. 2003;49(2):93‒105.
  7. Boyle-Vavra S, Daum RS. Community-acquired methicillin-resistant Staphylococcus aureus: the role of Panton–Valentine leukocidin. Lab Invest. 2007;87(1):3‒9.
  8. Zahed NS, Aminzadeh Z, Akhavi Mirab AS, et al . Nasal and Extra nasal methicillin resistant staphylococcus aureus colonization among hemodialysis patients; is routin culturing of other body sites necessary? Journal Renal Injury prevention. 2018;7(4):280‒285.
  9. Kali A, Stephen S, Umadevi S. Laboratory evaluation of phenotypic detection methods of methicillin-resistant Staphylococcus aureus. Biomed J. 2014;37(6):411‒414.
  10. M100-s24 performance standards for antimicrobial susceptibility testing. Wayne: Clinical and laboratory standards institute; 2014.
  11. Martineau F, Picard FJ, Roy PH, et al. Species-specific and ubiquitous-DNA-based assays for rapid identification of Staphylococcus aureus. J Clin Microbiol. 1998;36(3):618‒623.
  12. Dibah S, Arzanlou M, Jannati E, et al. Prevalence and antimicrobial resistance pattern of methicillin resistant Staphylococcus aureus (MRSA) strains isolated from clinical specimens in Ardabil, Iran. Iran J Microbiol. 2014;6(3):163‒168.
  13. Jarraud S, Mougel C, Thioulouse J, et al. Relationships between Staphylococcus aureus genetic background, virulence factors, agr groups (alleles), and human disease. Infect Immun. 2002;70(2):631‒641.
  14. Alfatemi SM, Motamedifar M, Hadi N, et al. Analysis of virulence genes among methicillin resistant Staphylococcus aureus (MRSA) strains. Jundishapur J Microbiol. 2014;7(6):e10741.
  15. Ito T, Katayama Y, Asada K, et al. Structural comparison of three types of staphylococcal cassette chromosome mec integrated in the chromosome in methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother. 2001;45(5):1323‒1336.
  16. Ito T, Ma XX, Takeuchi F, et al. Novel type V staphylococcal cassette chromosome mec driven by a novel cassette chromosome recombinase, ccrC. Antimicrob Agents Chemother. 2004;48(7):2637‒2651.
  17. Boye K, Bartels MD, Andersen IS, et al. A new multiplex PCR for easy screening of methicillin‐resistant Staphylococcus aureus SCCmec types I–V. Clin Microbiol Infect. 2007;13(7):725‒727.
  18. Johnson LB, Jose J, Yousif F, et al. Prevalence of colonization with community-associated methicillin-resistant Staphylococcus aureus among end-stage renal disease patients and healthcare workers. Infection Control & Hospital Epidemiology. 2009;30(1):4‒8.
  19. Ko KS, Lee JY, Suh JY, et al. Distribution of major genotypes among methicillin-resistant Staphylococcus aureus clones in Asian countries. J Clin Microbiol. 2005;43(1):421‒426.
  20. Dhawan B, Rao C, Udo EE, et al. Dissemination of methicillin-resistant Staphylococcus aureus SCCmec type IV and SCCmec type V epidemic clones in a tertiary hospital: challenge to infection control. Epidemiol Infect. 2015;143(2):343‒353.
  21. Papadimitriou-Olivgeris M, Drougka E, Fligou F, et al. Spread of Tst–Positive Staphylococcus aureus Strains Belonging to ST30 Clone among Patients and Healthcare Workers in Two Intensive Care Units. Toxins. 2017;9(9):E270.
  22. Hu DL, Omoe K, Inoue F, et al. Comparative prevalence of superantigenic toxin genes in meticillin-resistant and meticillin-susceptible Staphylococcus aureus isolates. J Med Microbiol. 2008;57(9):1106‒1112.
  23. Deurenberg RH, Nieuwenhuis RF, Driessen C, et al. The prevalence of the Staphylococcus aureus tst gene among community-and hospital-acquired strains and isolates from Wegener's Granulomatosis patients. FEMS Microbiol Lett. 2005;245(1):185‒189.
  24. Argudín MA, Argumosa V, Mendoza MC, et al. Population structure and exotoxin gene content of methicillin-susceptible Staphylococcus aureus from Spanish healthy carriers. Microb Pathog. 2013;54:26‒33.
  25. Paniagua-Contreras GL, Monroy-Pérez E, Vaca-Paniagua F, et al. Expression of enterotoxin-coding genes in methicillin-resistant Staphylococcus aureus strains isolated from Mexican haemodialysis patients. Ann Clin Microbiol Antimicrob. 2014;13:55.
  26. Hogan B, Rakotozandrindrainy R, Al-Emran H, et al. Prevalence of nasal colonisation by methicillin-sensitive and methicillin-resistant Staphylococcus aureus among healthcare workers and students in Madagascar. BMC Infect Dis. 2016;16(1):420.
  27. Al Laham N, Mediavilla JR, Chen L, et al. MRSA clonal complex 22 strains harboring toxic shock syndrome toxin (TSST-1) are endemic in the primary hospital in Gaza, Palestine. PLoS One. 2015;10(3):e0120008.
  28. Wang M, Zheng Y, Mediavilla JR, et al. Hospital Dissemination of tst-1-Positive Clonal Complex 5 (CC5) Methicillin-Resistant Staphylococcus aureus. Front Cell Infect Microbiol. 2017;7:101.
  29. Deurenberg RH, Vink C, Driessen C, et al. Rapid detection of Panton–Valentine leukocidin from clinical isolates of Staphylococcus aureus strains by real-time PCR. FEMS Microbiol Lett. 2004;240(2):225‒228.
Creative Commons Attribution License

©2019 Aminzadeh, et al. This is an open access article distributed under the terms of the, which permits unrestricted use, distribution, and build upon your work non-commercially.