Journal of
eISSN: 2572-8466
Submit manuscript...
Mini Review Volume 5 Issue 1
A true new gene in ophiocomina nigra: an ophuirid Igkappa gene
Michel Leclerc,1,2,3
Verify Captcha
Regret for the inconvenience: we are taking measures to prevent fraudulent form submissions by extractors and page crawlers. Please type the correct Captcha word to see email ID.
Yannick Marie,1 Dominique Davoult,2 Ariane Jolly,3 Pierre de la Grange3
Verify Captcha
Regret for the inconvenience: we are taking measures to prevent fraudulent form submissions by extractors and page crawlers. Please type the correct Captcha word to see email ID.
1Hopital de la Salpetriere, France
2Biologic Station of Roscoff, University Pierre et Marie Curie, France
3ICM Genosplice, France
Correspondence: Michel Leclerc, ICM, Hopital de la Salpetriere, 556 rue Isabelle Romee, 45640 Sandillon, France
Received: January 09, 2018 | Published: January 29, 2018
Citation: Leclerc M, Marie Y, Davoult D, et al. A true new gene in ophiocomina nigra: an ophuirid Igkappa gene. J Appl Biotechnol Bioeng. 2018;5(1):17-18. DOI: 10.15406/jabb.2018.05.00111
Abstract
An Igkappa gene was discovered in the transcriptome of the Ophuirid: Ophiocomina nigra. So, with the Asterid: Asterias rubens, 2 classes of Echinodermata, possess each an Igkappa gene. It remains enigmatic, when we have a look on the 3 other classes without this gene: The Echinids, Holothurids, and Crinoids.
Keywords: invertebrate, ophiocomina nigra, ophuirid igkappa gene, HRP
Introduction
Recently, investigations performed in our laboratory, have provided evidence, that the Ophuirid: Ophiocomina nigra (Echinodermata), presented antibody-like reactions with cellular and humoral reactions to peroxydase antigen. These reactions are similar to those observed in the sea star Asterias rubens, another Echinodermata1 and we know that the Asterias rubens genome contains the sea star Igkappa gene with Ig sites,2 a Fab gene, a Fc receptor gene. The aim of this work consists to explore immune genes in the genome of virgin Ophiocomina nigra.
Materials and methods
Ophiocomina nigra was collected to the Biologic station of Roscoff (France). Digestive coeca were excised and treated with Uptizol (Interchim) to obtain m RNA Ophiocomina nigra.
Preparation of library (RNA), by the use of the kappa mRNA hyper prep kit
Sequencing: the sequencing was done with a NextSEq 500 Illumina( 2.75 bases). Transcriptome was assembled from RNA-Seq fastq files using Trinity v2.1.13 with default parameters. A BLAST database was created with the assembled transcripts using makeblastdb application from ncbi-blast+ (v2.2.31+). The sequences of transcripts of interest were then blasted against this database using blastn application from ncbi-blast+4) with parameter word size 7.
Results
An obtained blast against homo sapiens was very highly significant (E-value of 2,00E-12). Undoubtly it brings the evidence of the existence of an Ophuirid-IGKappa gene (Table 1).
Query ID |
Query Name |
Subject ID |
Identity |
Length |
Mismatch |
Gapopen |
E-Value |
BC030813.1 |
Igk |
TRINITY_DN64572_c0_g1_i1 |
89.47 |
57 |
6 |
0 |
2,00E-12 |
Table 1 An obtained blast against homo sapiens was very highly significant (E-value of 2,00E-12)
The sequence follows
>BC030813.1 Homo sapiens immunoglobulin kappa locus, mRNA (cDNA clone MGC:22645 IMAGE:4700961), complete cds
5’GAGGAACTGCTCAGTTAGGACCCAGACGGAACCATGGAAGCCCCAGCGCAGCTTCTCTTCCTCCTGCT
ACTCTGGCTCCCAGATACCACTGGAGAAATAGTGATGACGCAGTCTCCAGCCACCCTGTCTGTGTCTCCA
GGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTGTTACCAGCAACTTAGCCTGGTACCAGCAG
ACACCTGGGCAGTCTCCCAGGCTCGTCATCTATGGTGCATCCAGCAGGGCCAGTGGTGTCCCAGCCAGG
TTCAGTGGCAGTGGGTCTGGGACAGAGTTCACTCTCACCATCAGCAGCCTGCAGTCTGAAGATTTTGCA
GTTTATTACTGTCAGCAGTATAATAAGTGGCCGCACACTTTTGGCCAGGGGACCAAGCTGGACATCAAA
CGAACTGTGGCTGCACCATCTGTCTTCATCTTCCCGCCATCTGATGAGCAGTTGAAATCTGGAACTGCC
TCTGTTGTGTGCCTGCTGAATAACTTCTATCCCAGGGAGGCCAAAGTACAGTGGAAGGTGGATAACGCC
CTCCAATCGGGTAACTCCCAGGAGAGTGTCACAGAGCAGGACAGCAAGGACAGCACCTACAGCCTCAGC
AGCACCCTGACGCTGAGCAAAGCAGACTACGAGAAACACAAAGTCTACGCCTGCGAAGTCACCCATCAG
GGCCTGAGCTCGCCCGTCACAAAGAGCTTCAACAGGGGAGAGTGTTAGAGGGAGAAGTGCCCCCACCTG
CTCCTCAGTTCCAGCCTGACCCCCTCCCATCCTTTGGCCTCTGACCCTTTTTCCACAGGGGACCTACCCC
TATTGCGGTCCTCCAGCTCATCTTTCACCTCACCCCCCTCCTCCTCCTTGGCTTTAATTATGCTAATGTT
GGAGGAGAATGAATAAATAAAGTGAATCTTTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 3’
Conclusion and discussion
A gene of about 960 nucleotides appears. It is longer than the one found in Asterias rubens (Asterid) in immunized sea stars to HRP.2 For the second time, “The classic immunology” is broken with the emergence, in Invertebrates, of a gene which has the property of Invertebrate primitive antibody. But it would be necessary to correlate this gene to the obtained immune reaction in Ophuirids. A bright avenir is opened in the field of comparative immunology.
Highlights
- In 2015 discovery of the sea star Igkappa gene
- Discovery of the sea star Primitive antibody
Acknowledgements
None.
Conflict of interest
The author declares no conflict of interest.
References
- Leclerc M, Brillouet C. Evidence of antibody-like substances secreted by axial organ cells of the starfish Asterias rubens. Immunology Letters. 1981;2(5-6):279–281.
- Nadine Vincent, Magne Osteras, Patricia Otten, et al. A new gene in A. rubens: A sea star Ig kappa gene. Meta Gene. 2014;2:320–322.
- Manfred G Grabherr, Brian J Haas, Moran Yassour, et al. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nature Biotechnology. 2011;29:644–652.
- Stephen F Altschul, Warren Gish, et al. Basic local alignment search tool. Journal of Molecular Biology. 1990;215(3):403–410.
©2018 Leclerc, et al. This is an open access article distributed under the terms of the, which permits unrestricted use, distribution, and build upon your work non-commercially.