Submit manuscript...
Journal of
eISSN: 2373-437X

Microbiology & Experimentation

Research Article Volume 10 Issue 3

Diversity of staphylococcal cassette chromosome mec (SCCmec) types among methicillin-resistant coagulase-negative staphylococci (MR-CoNS)

Huda Saber, Azmiza Jasni, TZMT Jamaluddin, Rosni Ibrahim

Department of Medical Microbiology and Parasitology, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, Malaysia

Correspondence: Dr. Rosni Ibrahim, Master of Pathology (MPath) (Universiti Kebangsaan Malaysia), Medical Doctor (MD) (University Sains Malaysia), Department of Medical Microbiology and Parasitology, Faculty of Medicine & Health Sciences, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor Darul Ehsan, Malaysia, Tel 03 89472363

Received: May 26, 2022 | Published: June 9, 2022

Citation: Saber H, Jasni A, Jamaluddin TZMT, et al. Diversity of staphylococcal cassette chromosome mec (SCCmec) types among methicillin-resistant coagulase-negative staphylococci (MR-CoNS). J Microbiol Exp. 2022;10(3):99-107. DOI: 10.15406/jmen.2022.13.00359

Download PDF

Abstract

Methicillin-resistant coagulase-negative staphylococci (MR-CoNS) have become one of the important causes of nosocomial infections yet their clinical data in Malaysia is scarce compared to methicillin-resistant Staphylococcus aureus (MRSA). Staphylococcal Cassette Chromosome mec (SCCmec) genes play roles in their pathogenicity. This study thus aimed to determine species distribution, antimicrobial susceptibility pattern and SCCmec types among MR-CoNS isolated from blood cultures. A laboratory-based descriptive study was involved with non-probability sampling method. One hundred CoNS isolated from blood cultures were collected from Microbiology laboratory, Hospital Serdang and proceeded with phenotypic identification, antimicrobial susceptibility testing, mecA gene detection and SCCmec types classification. Staphylococcus epidermidis was the most common isolated MR-CoNS species. All 100 isolates were resistant to penicillin while being sensitive to vancomycin. The predominant SCCmec Type IV was observed in S. epidermidis which exhibited 100% resistant to penicillin and erythromycin besides dominating multiple antibiotic resistance. Meanwhile, the combination type was observed in type I & IVa (n=9, 9%) whereas 31 strains (31%) were non-typeable. Besides demonstrating MR-CoNS susceptibility pattern variations to commonly used antimicrobials for treatment of staphylococcal infections, this study could also preliminarily contribute in providing more local epidemiological data regarding MR-CoNS.

Keywords: antimicrobial susceptibility pattern, mecA, MR-CoNS, SCCmec, species distribution

Abbreviations

CLSI, Clinical and Laboratory Standards Institute; CoNS, coagulase-negative staphylococci; MR-CoNS, methicillin-resistant coagulase-negative staphylococci; SCCmec, staphylococcal cassette chromosome mec

Introduction

Coagulase-negative staphylococci (CoNS) are normal flora that are found in mucous membranes and skin of mammals1 and have been reported causing nosocomial infections.2 They have the capability to produce biofilms for adherence to medical devices in hospitals, making them more successful in causing  infections such as foreign body-related infections (FBRIs), preterm newborns infections and endocarditis.2,3 These biofilm-producing CoNS have been reported to increasingly become resistant to methicillin and multiple antibiotics groups such as lincosamides and macrolides.3,4 This matter can lead to serious clinical infections and becomes challenging in patients’ treatments in term of antibiotic prescription.2,5 Sanches et al.,6 had also studied that cross resistance occurred in methicillin-resistant staphylococci whereby 72.3% was observed in MR-CoNS.

Widely spread in hospitals, the most MR-CoNS species isolated include S. epidermidis and S. haemolyticus.7 These organisms harbour mecA gene encoding penicillin-binding protein 2a (PBP2a) which allows only low binding to β-lactam antibiotics.2,8 The mecA gene is attained by SCCmec, a mobile genetic element.9 This element acquires two extensive components which are mec gene and cassette chromosome recombinase (ccr) gene complexes.10,11 The mec gene complex expresses methicillin resistance function whereas ccr and a few surrounding genes mediate integration and excision of SCCmec into and from the chromosome.10,11 Specific combinations of both complexes produce different types of SCCmec which include I-XI and an isolate may possess more than one type.11 Apart from that, SCCmec also possesses J regions that are applied in determining SCCmec subtypes, as well as a number of non-essential components which may carry additional antimicrobial resistance genes.10 Staphylococcal casette chromosome mec (SCCmec) types III, IV and V were prevalently found in MR-CoNS.11

Since the data related to MR-CoNS are limited in Malaysia, this study is conducted to determine the distribution of MR-CoNS species isolated from blood cultures, to observe their antimicrobial susceptibility profile, to detect their SCCmec types and to determine the antimicrobial susceptibility pattern of the SCCmec types. The outcomes from this research particularly on the SCCmec genes, can be a set of preliminary data that may be used for further research to assist on management of MR-CoNS infections.

Material and methods

Bacterial identification

Staphylococci isolated from blood cultures were cultured on blood agar (BA) and the colony morphology was observed. They were subjected to phenotypic identification by performing gram-staining, catalase and coagulase tests. They were further identified up to species by using API® Staph kit. The results were interpreted according to the reference table provided and species was identified by entering the results in apiwebTM website. The CoNS isolates were stored in cryobeads (CryoCareTM) for further use.

Antimicrobial susceptibility testing

Kirby-Bauer disc diffusion method was performed using nine antibiotic discs (Oxoid, UK); cefoxitin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, fucidic acid, gentamicin, penicillin, rifampicin and vancomycin. Zones of inhibition were observed and referred with the interpretive criteria according to Clinical and Laboratory Standards Institute (CLSI) 2016 (Table 1). Isolates resistant to cefoxitin (30 µg) (≤21 mm clear zone diameter) were indicated as MR-CoNS and kept aside for further confirmation.

Antimicrobial Agent (µg)

Zone Diameter Interpretive criteria (nearest whole mm)

Sensitive

Resistant

Penicillin (10)

≥ 29

≤ 28

Cefoxitin (30)

≥ 22

≤ 21

Gentamicin (10)

≥ 15

≤ 12

Erythromycin (15)

≥ 23

≤13

Clindamycin (2)

≥ 21

≤ 14

Rifampicin (5)

≥20

≤ 16

Trimethoprim-Sulfamethoxazole (1.25/23.75)

≥ 16

≤ 10

Fucidic acid (10)

≥ 22

≤ 14

Vancomycin (30)

≥ 22

≤ 14

Table 1 Antimicrobial agents and their respective zone diameter interpretive criteria for coagulase-negative staphylococci (CoNS)

(Source: Adapted from CLSI 2016)

Detection of mecA gene

Genomic DNA was extracted by using AxyPrep Bacterial Genomic DNA Extraction Kit (Axygen, USA) and the DNA purity was measured by using NanoDrop (Thermo Scientific, USA). The presence of mecA gene was detected by using forward (5′-TCCAGATTACAACTTCACCAGG-3′) and reverse (5′-CCACTTCATATCTTGTAACG-3′) primers as proposed by Ghaznavi-Rad et al.12 Positive and negative controls were S. epidermidis ATCC 35984 and S. epidermidis ATCC 12228, respectively. A total of 20µL PCR mixture contained 10µL master mix (Thermo Scientific, USA), 10µM 0.5µL of each primer, 1µL DNA template and 8µL nuclease free water. The reaction was carried out in Bio-Rad MyCyclerTM, USA starting with 1 cycle of initial denaturation at 98°C for 30 seconds followed by 28 cycles of denaturation (98°C, 10 seconds), annealing (52°C, 30 seconds), and extension (72°C, 30 seconds) and finally 1 cycle of final extension at 72°C before holding at 4°C. The PCR amplicons were performed gel electrophoresis (58 V, 120 minutes) in 1.4% agarose gel containing 0.5µl gel stain (Bioteke, China). DNA ladder of 100 bp (Vivantis, Malaysia) was used as a standard marker. The gel was visualized under UV light and the image was captured using gel imager (Major Science, USA). One hundred confirmed mecA-positive CoNS (MR-CoNS) isolates were stored for further gene detection.

 Staphylococcal Cassette Chromosome mec (SCCmec) Typing

A multiplex PCR assay was first optimized by using primers of respective control strains as described in Table 2. A total of 20µL PCR mixture contained 10µL multiplex PCR master mix (Thermo Scientific, USA), 10µM 0.2µL of respective forward and reverse primers for each staphylococcal cassette chromosome mec (SCCmec) type including mecA, 1µL DNA template and 3.8µL nuclease free water. It was performed by using Bio-Rad MyCyclerTM (USA) thermocycler beginning with an initial denaturation step at 98°C for 30 seconds followed by 28 cycles of denaturation (98°C, 10 seconds), annealing (52°C, 30 seconds), and extension (72°C, 30 seconds) and finally 1 cycle of final extension at 72°C before holding at 4°C. Gel electrophoresis (58 V, 120 minutes) in 1.4% agarose gel containing 0.5µl gel stain (Bioteke, China) was performed with 100 bp plus DNA ladder (Vivantis, Malaysia) was used as a standard marker. The gel was visualized under UV light and the image was captured using gel imager (Major Science, USA). Representative strain of each successfully detected SCCmec types was sent to MyTACG (Malaysia) for sequencing. Sequencing analysis was performed accordingly by using Basic Local Alignment Search Tool (BLASTn) available in National Center for Biotechnology (NCBI) website.

Primer

Oligonucleotide sequence (5’ – 3’)

Control strain

References

Type I

F: GCTTTAAAGAGTGTCGTTACAGG

NCTC10442

Ghaznavi-Rad et al.,12

(613 bp)

R: GTTCTCTCATAGTATGACGTCC

Zhang et al.,13

McClure-Warnier et al.,14

Type II

F: GATTACTTCAGAACCAGGTCAT

N315

Ghaznavi-Rad et al.,12

(287 bp)

R: TAAACTGTGTCACACGATCCAT

Zhang et al.,13

McClure-Warnier et al.,14

Kondo et al.,15

Type III

F: CATTTGTGAAACACAGTACG

85/2082

Ghaznavi-Rad et al.,12

(243 bp)

R: GTTATTGAGACTCCTAAAGC

Zhang et al.,13

McClure-Warnier et al.,14

Milheirico et al.,16

Type IVa

F: GCCTTATTCGAAGAAACCG

CA05

Ghaznavi-Rad et al.,12

(776 bp)

R: CTACTCTTCTGAAAAGCGTCG

Zhang et al.,13

McClure-Warnier et al.,14

Type IVb

F: AGTACATTTTATCTTTGCGTA

8/6-3P

Ghaznavi-Rad et al.,12

(1000 bp)

R: AGTCATCTTCAATATGGAGAAAGTA

Zhang et al.,13

McClure-Warnier et al.,14

Type IVc

F: TCTATTCAATCGTTCTCGTATT

MR108

Ghaznavi-Rad et al.,12

(677 bp)

R: TCGTTGTCATTTAATTCTGAACT

McClure-Warnier et al.,14

Ma et al.,17

Type IVd

F: AATTCACCCGTACCTGAGAA

JCSC4469

Ghaznavi-Rad et al.,12

(1242 bp)

R: AGAATGTGGTTATAAGATAGCTA

McClure-Warnier et al.,14

Kondo et al.,15

Type IVg

F: TGATAGTCAAAGTATGGTGG

JCSC 6673

Milheirico et al.,16

(792 bp)

R: GAATAATGCAAAGTGGAACG

Type IVh

F: TTCCTCGTTTTTTCTGAACG

JCSC 6674

Ghaznavi-Rad et al.,12

(663 bp)

R: CAAACACTGATATTGTGTCG

Milheirico et al.,16

Type V

F: GAACATTGTTACTTAAATGAGCG

WIS

Ghaznavi-Rad et al.,12

(325 bp)

R: TGAAAGTTGTACCCTTGACACC

Zhang et al.,13

McClure-Warnier et al.,14

Type VI

F: GAGGGATGGAGTGGATGAGATA

HDE288

Chen et al.,18

(415 bp)

R: GGTGAAGGACGATGAATGAGTAG

Type VIII

F: CGAAGTAGTGATAGCCGCATAG

C10682

Chen et al.,18

(901 bp)

R: GTATGGATGATCGGGCGTTAG

mecA

F: TCCAGATTACAACTTCACCAGG

S. epidermidis

Ghaznavi-Rad et al.,12

(162 bp)

R: CCACTTCATATCTTGTAACG

ATCC 35984

Table 2 Details of primers used for detection of Staphylococcal Cassette Chromosome mec (SCCmec) types

Note: F, forward primer; R, reverse primer

Results

Species distribution in MR-CoNS

Among 100 MR-CoNS, Staphylococcus epidermidis was the most common isolated species (n=56, 56%) followed by Staphylococcus haemolyticus (n=19, 19%), Staphylococcus chromogenes (n=12, 12%), Staphylococcus xylosus (n=6, 6%), Staphylococcus hominis (n=5, 5%), Staphylococcus capitis (n=1, 1%) and Staphylococcus cohnii (n=1, 1%) (Table 3).

Species

Number of Isolates (n)

Percentage (%)

 S. epidermidis

56

56

 S. haemolyticus

19

19

 S. chromogenes

12

12

 S. xylosus

6

6

 S. hominis

5

5

 S. capitis

1

1

 S. cohnii

1

1

Total

100

100

Table 3 Species distribution among 100 methicillin-resistant coagulase-negative staphylococci (MR-CoNS) isolated from blood cultures

 Antimicrobial susceptibility pattern

Figure 1 shows the susceptibility pattern against nine antibiotic discs among the cefoxitin-resistant CoNS isolates. One hundred percent resistance was observed towards cefoxitin and penicillin, followed by erythromycin (87%), fucidic acid (70%), trimethoprim-sulfamethoxazole (SXT) (57%), gentamicin (55%), clindamycin (51%) and rifampicin (29%). Meanwhile, all isolates were susceptible to vancomycin.

Figure 1 Antimicrobial susceptibility pattern of 100 methicillin-resistant coagulase negative staphylococci (MR-CoNS) isolates.

Staphylococcal Cassette Chromosome mec (SCCmec) Typing

Twelve reference strains plus methicillin-resistance control strain (S. epidermidis ATCC 35984) were used as summarized in Figure 2.

Figure 2 Multiplex PCR products of staphylococcal cassette chromosome mec (SCCmec) types in control strains. MM, DNA molecular mass size marker (VC 100 bp Plus DNA ladder, Vivantis).

As shown in Table 4, the most common SCCmec type was IVa (n=32, 32%) followed by VIII (n=8, 8%) and V (n=6, 6%). Other types were also detected but with low distribution; type III (n=3, 3%), IVh (n=2, 2%), I (n=2, 2%) and IVb (n=1, 15). Fifteen (15%) combination types were detected as well with type I & IVa being the most common (n=9, 9%) followed by IVa & VIII (n=2, 2%), V & VIII (n=2, 2%) and II, V & VIII (n=2, 2%).  Another 31 strains (31%) were non-typeable. Table 4 also shows that type IVa was most commonly found in S. epidermidis (n=27, 48.2%) compared to in other species. Figure 3 shows the distribution of SCCmec types among 23 S. epidermidis representative strains.

SCCmec Type (n)

MR-CoNS Species

S. epidermidis

S. haemolyticus

S. chromogenes

S. xylosus

S. hominis

S. capitis

S. cohnii

(n=56)

(n=19)

(n=12)

(n=6)

(n=5)

(n=1)

(n=1)

I (2)

2 (3.6)

0 (0)

0 (0)

0 (0)

0 (0)

0 (0)

0 (0)

III (3)

2 (3.6)

0 (0)

0 (0)

0 (0)

1 (20)

0 (0)

0 (0)

IVa (32)

27 (48.2)

3 (15.8)

2 (16.7)

0 (0)

0 (0)

0 (0)

0 (0)

IVb (1)

1 (1.8)

0 (0)

0 (0)

0 (0)

0 (0)

0 (0)

0 (0)

IVh (2)

2 (3.6)

0 (0)

0 (0)

0 (0)

0 (0)

0 (0)

0 (0)

V (6)

5 (8.9)

0 (0)

0 (0)

0 (0)

0 (0)

1 (100)

0 (0)

VIII (8)

0 (0)

1 (5.3)

2 (16.7)

3 (50)

1 (20)

0 (0)

1 (100)

 I & IVa (9)

9 (16.1)

0 (0)

0 (0)

0 (0)

0 (0)

0 (0)

0 (0)

IVa & VIII (2)

0 (0)

1 (5.3)

1 (8.3)

0 (0)

0 (0)

0 (0)

0 (0)

V & VIII (2)

0 (0)

2 (10.5)

0 (0)

0 (0)

0 (0)

0 (0)

0 (0)

II, V & VIII (2)

0 (0)

2 (10.5)

0 (0)

0 (0)

0 (0)

0 (0)

0 (0)

Non-typeable (31)

8 (14.3)

10 (52.6)

7 (58.3)

3 (50)

3 (60)

0 (0)

0 (0)

Table 4 Staphylococcal Cassette Chromosome mec (SCCmec) types distribution among MR-CoNS species

Note: Percentages in brackets show the proportion of MR-CoNS isolates of a particular species harbouring one SCCmec type

Figure 3 Detection of SCCmec types in S. epidermidis strains. S1, 9, 12, 13, 14, 17, 18, 19, 20, 21, type IVa (776 bp); S2, 4, 16, type V (325 bp); S3, 5, 7, 22, type I & IVa (613 bp & 776 bp); S15, type IVh (663 bp); S6, 8, 10, 11, 23, non-typeable; MM, DNA molecular mass size marker (VC 100 bp Plus DNA ladder, Vivantis). S1-S23 were representative strains of S. epidermidis.

Antimicrobial susceptibility pattern among staphylococcal cassette chromosome mec (SCCmec) types

Type IVa which was the most common type found in this study exhibited high resistance rates towards both erythromycin (n=32, 100%) and penicillin (n=32, 100%), followed by fucidic acid (n=25, 78.1%) and clindamycin (n=24, 75%) (Table 5). Type IVa was observed to predominantly dominating multiple antibiotic resistance compared to other types. While three combinations of I & IVa (n=9), IVa & VIII (n=2) and II, V, VIII (n=2) showed 100% resistance rates towards erythromycin, four combinations of I & IVa (n=9), IVa & VIII (n=2), V & VIII (n=2) and II, V, VIII (n=2) showed 100% resistance towards penicillin. As for the 31 non-typeable strains, all of them exhibited 100% resistance to penicillin followed by erythromycin (n=25, 80.7%) and fucidic acid (n=21, 67.7%). They also showed resistance to multiple antibiotics.

Antibiotics (n)

SCCmec Type

I

III

IVa

IVb

IVh

V

VIII

I & Iva

IVa & VIII

V & VIII

II, V & VIII

Non-typeable

(n=2)

(n=3)

(n=32)

(n=1)

(n=2)

(n=6)

(n=8)

(n=9)

(n=2)

(n=2)

(n=2)

(n=31)

Clindamycin

0 (0)

0 (0)

24 (75.0)

0 (0)

0 (0)

0 (0)

6 (75)

9 (100)

1 (50.0)

0 (0)

1 (50.0)

10 (32.3)

Erythromycin

1 (50.0)

3 (100)

32 (100)

1 (100)

2 (100)

2 (33.3)

8 (100)

9 (100)

2 (100)

0 (0)

2 (100)

25 (80.7)

Fucidic acid

1 (50.0)

3 (100)

25 (78.1)

0 (0)

1 (50.0)

3 (50.0)

7 (87.5)

7 (77.8)

1 (50.0)

0 (0)

1 (50.0)

21 (67.7)

Gentamicin

2 (100)

3 (100)

19 (59.4)

0 (0)

1 (50.0)

2 (33.3)

5 (62.5)

8 (88.9)

1 (50.0)

0 (0)

1 (50.0)

13 (41.9)

Penicillin

2 (100)

3 (100)

32 (100)

1 (100)

2 (100)

6 (100)

8 (100)

9 (100)

2 (100)

2 (100)

2 (100)

31 (100)

Rifampin

0 (0)

0 (0)

14 (43.8)

0 (0)

0 (0)

0 (0)

2 (25.0)

1 (11.1)

1 (50.0)

0 (0)

1 (50.0)

10 (32.3)

SXT

1 (50.0)

3 (100)

18 (56.3)

0 (0)

0 (0)

0 (0)

7 (87.5)

9 (100)

2 (100)

0 (0)

1 (50.0)

16 (51.6)

Vancomycin

0 (0)

0 (0)

0 (0)

0 (0)

0 (0)

0 (0)

0 (0)

0 (0)

0 (0)

0 (0)

0 (0)

0 (0)

Table 5 Distribution of SCCmec types in MR-CoNS according to resistance pattern to antibiotics

Note: Percentages in brackets show the proportion of MR-CoNS of one particular SCCmec type being resistant to an antibiotic. Percentages do not add to give a value of 100 since one isolate can be resistant to more than one antibiotic

Discussion

In this present study, S. epidermidis (56%) was found as the most common isolated MR-CoNS species followed by S. haemolyticus (19%). These results are similar to the findings reported by Khan et al.,19 whereby S. epidermidis was the most common isolated strain (75.8%) in clinical blood cultures followed by S. haemolyticus (11.1%). Sani et al.,20 found that S. epidermidis was the most prevalent species identified in University Kebangsaan Malaysia Medical Centre (UKMMC) in 2009 while Pereira and Cunha21 reported that 82% of their isolated strains from neonatal blood cultures in a Brazilian hospital were S. epidermidis. In one Turkish hospital, out of 200 CoNS isolated from blood samples between year 1999 to 2006, S. epidermidis was reported as the most prevalent species (n=87) followed by S. haemolyticus (n=23).22 Supported by Becker et al.,2 S. epidermidis often colonizes foreign bodies and associated with bloodstream infections since it is a major skin colonizer that can easily contaminate blood. However, studies done in India23 and Thailand24s reported contrast results with S. haemolyticus being the most common species isolated before S. epidermidis.

Distribution percentages in S. chromogenes (12%), S. xylosus (6%), S. hominis (5%), S. capitis (1%) and S. cohnii (1%) were also found similar to several studies. Staphylococcus chromogenes was once described as a rare human pathogen but it is becoming a more serious nosocomial pathogen and has been implicated in blood stream infections among a number of patients in Nigeria, whereby 5% has been isolated from clinical samples.25 On the other hand, Staphylococcus xylosus has been reported as an important cause of bacteraemia in India.26  Azih and Enabulele27 found S. xylosus (10%) as the only CoNS species isolated from blood samples. Meanwhile, 4% of S. hominis was isolated from blood samples in Iran.7 Chaves et al.,28 found that S. hominis was the main cause of sepsis in neonatal intensive care units (NICUs) in Spain and Roy et al.,29 observed that methicillin-resistance S. hominis has been causing septicaemia among cancer patients. As for S. capitis, 3% was isolated from blood samples.7 Being one of the emerged nosocomial pathogens, 28.6% S. capitis was known to cause prosthetic joint infections,30 endocarditis31 and catheter-related bacteraemia.32 Whilst, S. cohnii has been isolated in the cases of bacteraemia and septicaemia to patients with colon and pressure ulcers.33,34 This strain has the least distribution (1%) among blood samples in Iran.7 All of these studies showed that factors such as geography, environments and types of sample may influence the epidemiology of health-care associated CoNS and their species distribution.23,23,35,36

In terms of antimicrobial susceptibility, three antibiotics with the highest resistance which are penicillin, erythromycin and fucidic acid, are to be mainly discussed. This recent study found that MR-CoNS were most highly resistant towards penicillin and erythromycin. This resistance pattern was similar to a study conducted by Sani et al.,20 which found that their CoNS were most commonly resistant to penicillin (98.7%) followed by erythromycin (60%). This is due to the high use of penicillin as an old drug, to treat staphylococcal infection while erythromycin and clindamycin are commonly used to treat outpatients. As other studies also reported, majority of CoNS which are resistant to methicillin are well adapted to other antibiotics.20,37,38 Positive-mecA CoNS strains were reported to be more resistant to antibiotics such as erythromycin and clindamycin compared to mecA-negative strains.22,39 Akpaka et al.,40 mentioned that CoNS were reported to be inherently resistant to penicillin and its prolonged usage helps in increasing the number of methicillin-resistant staphylococci. Erythromycin and clindamycin were reported to be commonly used in treating outpatients41 thus may have contributed in the increasing rate of resistance in both antibiotics among MR-CoNS. Meanwhile, Duran et al.,42 however obtained highest resistance to clindamycin (54.7%), followed by SXT (40.9%) and erythromycin (38.4%) among their 159 CoNS strains.  They concluded that such difference in level of resistance as compared to other studies occurred because the antibiotics have been widely used in their region.42 In India, Ahmed et al.,43 had observed 100% resistance in co‑trimoxazole besides penicillin. Similar results obtained by Murugesan et al.,44 where the highest resistance was to cotrimoxazole (n= 13, 26%) which these contrary findings may be because of their isolates which were isolated from community settings that may have different reactions towards antimicrobial susceptibility pattern.

On top of that, 70% of the isolates were resistant to fucidic acid which made it as the third most percentage of resistance. It could be due to the frequent use of fucidic acid in treating outpatients especially for skin infections.  Resistance rate in fucidic acid has been increasing in developed regions such as in Australia and some parts of Europe due to its common use in treating staphylococcal skin infections.45 Castanheira et al.,46 reported that higher rate of fucidic acid resistance occurs in MR-CoNS (9.2%) than in methicillin-susceptible CoNS (5.2%). Howden and Grayson45 as well as Castanheira et al.,46 concluded that factors such as methicillin-resistance gene harbouring and frequent use of fucidic acid in treatments help to contribute to the high rate of fucidic acid resistance. In comparison to above findings, Murugesan et al.,44 observed only 10% of fucidic acid resistance among their MR-CoNS isolated from nasal swabs in community setting.

Additionally, the finding in respect to 100% sensitivity towards vancomycin reported in this recent study was supported by Sani et al.20, Ahmed et al.,43 and Bhatt et al.,47 where all of their CoNS isolates were also susceptible to vancomycin. As mentioned by Al-Tayyar et al.48, antibiotics such as vancomycin and rifampicin are still used in preventing and treating CoNS infections until recently. As can be seen, the variation of antimicrobial resistance pattern may be influenced by inappropriate use of antibiotics to treat staphylococcal infections in which some of the patients might seek treatment as outpatients where the compliance is difficult to assess. This is supported by other studies that also observed an increasing trend of resistance due to factors such as poor infection control practices, bacterial pathogenicity and inappropriate use of antibiotics.49,50

In regards to the distribution of SCCmec types, similar outcome was found between this study and Garza-Gonzalez et al.,51 whereby the most detected SCCmec type was IVa. Mert et al.,52 had reported that generally, majority of MR-CoNS isolated from blood harboured SCCmec type IV (n=65, 24.9%) while Sani et al.,53 found that type IV as the most common (42%) in clinical samples. In contrast, type III was observed as the most commonly distributed in Brazil in which more than 50% were isolated from blood cultures from 1990 to 2009.21 Previous study by Zong et al.,11 also reported that either single or in combination, the most common type among their 84 MR-CoNS was type III (n=33, 39.3%) followed by V (n=31, 36.9%) and IV (n=17, 20.2%). Similar findings reported by Chen et al.,54 whereby the predominant type was type III followed by type V. The differences in SCCmec type distribution in MR-CoNS in this present study as well as other previous studies were probably due to host species and geographical regions as also reported by Zong et al.11 For instance, Wisplinghoff et al.,55 and Ibrahem et al.,56 reported that type IV has been found the most in Finland (33%) and United Kingdom (36%) respectively whereas type III was the predominant type (52%) in southern Brazil.57 Meanwhile, type II was the most prevalent type in China58 and Nigeria.59 In addition, the SCCmec type distribution may also probably be influenced by horizontal gene transfer of SCCmec which eventually results in new variants with enhanced antimicrobial resistance and virulence level.60 On the other hand, point mutation, recombination, and deletion, with host & environmental pressures, may also lead to evolution of SCCmec.61 

In this present study, type IVa was most widely distributed in S. epidermidis. From Figure 3, it can be seen that type IVa was mostly detected among the 23 representative of S. epidermidis strains. Similarity found in a study by Jamaluddin et al.,62 that reported type IVa as the predominant type in S. epidermidis isolated from clinical samples in Japan. Barbier et al.,63 also described that type IVa was very common in S. epidermidis. Ruppe et al.,64 that suggested an association of type IV with S. epidermidis, further clarified that settings, sampling method, demographic information and number of patients may influence the SCCmec type distribution. Type IVa was also common among S. haemolyticus (n=3, 15.8%) and S. chromogenes (n=2, 16.7%) strains. This is probably due to their serious association with human infections.25,65 As for the other species that did not harbour type IVa in this recent study, this may be because their isolates number were too low compared to S. haemolyticus and S. chromogenes. This study also found that combination type of I & IVa (n=9, 16.1%) was all harboured by S. epidermidis while S. haemolyticus and S. chromogenes respectively harboured combination type of IVa & VIII (n=1, 5.3% and n=1, 8.3%). On the other hand, type V & VIII (n=2, 10.5%) and II, V & VIII (n=2, 10.5%) were fully harboured by S. haemolyticus.

There were a few limitations in this present study which include the inability of the multiplex PCR to detect five SCCmec types (IVc, IVd, IVg, VI and VII) where these types could be harboured by the 31 non-typeable strains. This may be due to errors such as the cassette chromosome recombinase (ccr) genes might have been accidently deleted, unrecognized or their primer regions were mutated in which these factors may happen beyond our concern thus lead to unsuccessful type detection.66 In addition, certain types such as VI and VII have not yet been identified in MR-CoNS.11,56,63,64 The method however, could still detect quite a variety of types compared to some previous studies that were able to detect lesser types.

In this present study, multiple antibiotic resistance was commonly seen in SCCmec type IVa probably due to the influence of high number of MR-CoNS strains dominating this particular type. These observations were also reported by other studies summarizing that the difference in resistance pattern among SCCmec types may be influenced by factors such as number of isolates, type of predominant species and isolation settings.23,44

Antimicrobial susceptibility patterns among SCCmec types were also observed. Similarly, Sani et al.,53 also observed that more than half of their MR-CoNS strains (56.3%) had the most resistance towards penicillin (81.2%) and erythromycin (53.3%), with SCCmec type IVa being the predominant type. Murugesan et al.,44 however did not find type IVa as the most common type but this particular type did indicate multiple antibiotic resistance with 5/9 antibiotics resistance proportion. They further reported that type I was the type possessing multiple antibiotic resistance (7/9 antibiotics). This was probably due to the significant high number of SCCmec type I isolates (n=15, 30%).44 Ghosh et al.,23 also found that the most detected type in their study which was type I (61.4%) had strong resistance rates towards tested antibiotics, besides obtaining S. haemolyticus (n=29, 64.4%) as the most isolated species above S. epidermidis (n=6, 26.1%) among 44 MR-CoNS isolates.

Conclusion

In this recent study, Staphylococcus epidermidis was found as the most common isolated methicillin-resistant coagulase-negative staphylococci (MR-CoNS) from blood samples and they exhibit variation results in antimicrobial resistance pattern. Staphylococcal cassette chromosome mec (SCCmec) type IVa was the most common type detected and it showed 100% resistance towards penicillin and erythromycin followed by multiple antibiotic resistance towards other tested antibiotics. It was also predominantly found in S. epidermidis. Even though coagulase-negative staphylococci (CoNS) are low pathogenic Gram positive bacteria, but they may cause significance serious infection in high risk group of patients. Usage of vascular catheter and prosthetic devices are among the risk associated with CoNS infection. However, that information was not included in the research objectives of this study.  Findings from the current research provides local baseline of epidemiological data regarding MR-CoNS species distribution, antimicrobial susceptibility profile and distribution of SCCmec that may aid future research. Perhaps more clinical data should be included in further studies to determine the clinical significance of CoNS that may help the management of patients.

Acknowledgments

A bunch of appreciation to my supervisory committees, Dr Rosni Ibrahim, Dr. Azmiza Syawani Jasni and Dr. Tengku Zetty Maztura Tengku Jamaluddin for the endless supports throughout the journey of this research. Special thanks to Professor Dr. Keiichi Hiramatsu and Associate Professor Dr. Yuki Uehara from Juntendo University (Tokyo), Professor Dr. Robert Daum from University of Chicago (Illinois), Professor Dr. Anders Rhod Larsen from Statens Serum Institut (Copenhagen), Professor Dr. Herminia de Lencastre from The Rockefeller Univeristy (New York) and Associate Professor Dr. Neoh Hui Min from UKM Medical Molecular Biology Institute (Kuala Lumpur) for giving permission and assistance in providing SCCmec types controls. Thank you to the Head of Microbiology Unit, Pathology Department of Hospital Serdang (Selangor), Dr. Lailatul Akmar Mat Nor as well as other staff for their cooperation and guidance throughout the sample collection process. We would like to acknowledge National Institutes of Health (NIH) and Medical Research and Ethics Committee (MREC) UPM for providing ethical approvals. Not forgetting, UPM IPS Grant (9507200) for the financial support throughout this project.

Authors’ contributions

RI, AJ and TZMTJ formulated the ideas of this study, supervised and advised the study design. RI, AJ, TZMTJ and HS developed the study concept and designed the experiments. HS planned and performed the experiments. RI and HS participated in manuscript drafting and data analysis. RI, AJ, TZMTJ and HS were involved with the manuscript preparation, editing and finalizing. All authors read and approved the finalized manuscript.

Funding

This research was funded by Universiti Putra Malaysia (UPM) IPS Grant, number 9507200.

Ethics approval

Ethical approval was obtained from the Ethics Committee of the university (Ref. No: (05) KKM/NIHSEC/P16-1032.

Availability of data and materials

All data generated and analysed in this study are included in this published article.s

Competing interests

All authors had experienced no competing interest in conducting this study.

References

  1. Widerström M. Molecular epidemiology of coagulase-negative staphylococci in hospitals and in the community. Doctoral dissertation, Umeå university; 2010. 74 p.
  2. Becker K, Heilmann C, Peters G. Coagulase-negative staphylococci. Clinical Microbiology Reviews. 2014;27(4):870‒926.
  3. Fredheim EG, Klingenberg C, Rohde H, et al. Biofilm formation by Staphylococcus haemolyticus. Journal of       Clinical Microbiology. 2009;47(4):1172‒1180.
  4. Otto M. Staphylococcal biofilms. In: Bacterial biofilms. Springer: Berlin, Heidelberg; 2008. 207‒228 p.
  5. Wojtyczka RD, Orlewska K, Kępa M, et al. Biofilm formation and antimicrobial susceptibility of Staphylococcus epidermidis strains from a hospital environment. International Journal of Environmental Research and Public Health. 2014;11(5):4619‒4633.
  6. Sanches IS, Mato R, De Lencastre H, et al. Patterns of multidrug resistance among methicillin-resistant hospital isolates of coagulase-positive and coagulase-negative staphylococci collected in the international multicenter study RESIST in 1997 and 1998. Microbial Drug Resistance. 2000;6(3):199‒211.
  7. Mehdinejad M, Sheikh AF, Jolodar A. Study of methicillin resistance in Staphylococcus aureus and species of coagulase negative staphylococci isolated from various clinical specimens. Pak J Med Sci. 2008;24(5):719‒724.
  8. Hartman BJ, Tomasz AL. Low-affinity penicillin-binding protein associated with beta-lactam resistance in Staphylococcus aureus. Journal of Bacteriology. 1984;158(2):513‒516.
  9. Wielders CL, Fluit AC, Brisse S, et al. mecA gene is widelydisseminated in Staphylococcus aureus population. Journal of Clinical Microbiology. 2002;40(11):3970‒3975.
  10. International Working Group on the Classification of Staphylococcal Cassette        Chromosome Elements (IWG-SCC. Classification of staphylococcal cassette chromosome mec (SCCmec): guidelines for reporting novel SCCmec elements. Antimicrobial Agents and Chemotherapy. 2009;53(12):4961‒4967.
  11. Zong Z, Peng C, Lü X. Diversity of SCCmec elements in methicillin-resistant         coagulase-negative staphylococci clinical isolates. PLoS One. 2011;6(5):e20191.
  12. Ghaznavi-Rad E, Shamsudin MN, Sekawi Z, et al. A simplified multiplex PCR assay for fast and easy discrimination of globally distributed staphylococcal cassette chromosome mec types in meticillin-resistant Staphylococcus aureus. Journal of Medical Microbiology. 2010;59(10):1135‒1139.
  13. Zhang K, McClure JA, Elsayed S, et al. Novel multiplex PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus. Journal of Clinical Microbiology. 2005;43(10):5026‒50               33.
  14. McClure-Warnier JA, Conly JM, Zhang K. Multiplex PCR assay for typing of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus. Journal of Visualized Experiments. 2013;5(79):  50779.
  15. Kondo Y, Ito T, Ma XX, et al. Combination of multiplex PCRs for staphylococcal cassette chromosome mec type assignment: rapid identification system for mec, ccr, and major differences in junkyard regions. Antimicrobial Agents and Chemotherapy. 2007;51(1):264‒274.
  16. Milheiriço C, Oliveira DC, de Lencastre H. Multiplex PCR strategy for subtyping the staphylococcal cassette chromosome mec type IV in methicillin-resistant Staphylococcus aureus. Journal of Antimicrobial Chemotherapy. 2007;60(1):42‒48.
  17. Ma XX, Galiana A, Pedreira W, et al. Community-acquired methicillin-resistant Staphylococcus aureus, Uruguay. Emerging Infectious Diseases. 2005;11(6):973‒976.
  18. Chen L, Mediavilla JR, Oliveira DC, et al. Multiplex real-time PCR for rapid staphylococcal cassette chromosome mec typing. Journal of Clinical Microbiology. 2009;47(11):3692‒3706.
  19. Khan MM, Faiz A, Ashshi AM. Clinically significant Coagulase Negative Staphylococci         and their antibiotic resistance pattern in a tertiary care hospital. J Pak Med Assoc. 2014;64(10):1171‒1174.
  20. Sani NA, Sapri HF, Noordin A, et al. Species Identification of Coagulase Negative Staphylococci (CoNS) Isolates in Universiti Kebangsaan Malaysia Medical Centre (UKMMC). Asia-Pacific Journal of Molecular Medicine. 2011;1(1):1‒5.
  21. Pereira VC, Cunha MD. Coagulase-negative staphylococci strains resistant to         oxacillin isolated from neonatal blood cultures. Memórias do Instituto Oswaldo Cruz. 2013;108(7):939‒942.
  22. Koksal F, Yasar H, Samasti M. Antibiotic resistance patterns of coagulase-negative staphylococcus strains isolated from blood cultures of septicemic patients in Turkey. Microbiological research. 2009;164(4):404‒410.
  23. Ghosh A, Singh Y, Kapil A, et al. Staphylococcal Cassette Chromosome mec (SCCmec) typing of clinical isolates of coagulase-negative staphylocci              (CoNS) from a tertiary care hospital in New Delhi, India. The Indian journal of medical research. 2016;143(3):365‒370.
  24. Seng R, Kitti T, Thummeepak R, et al. Biofilm formation of methicillin-resistant coagulase negative staphylococci (MR-CoNS) isolated from community and hospital environments. PloS One. 2017;12(8):e0184172.
  25. Adeyemi AI, Sulaiman AA, Solomon BB, et al. Bacterial bloodstream infections in HIV-infected adults attending a Lagos teaching hospital. Journal of health, population, and nutrition. 2010;28(4):318‒326.
  26. Begum ES, Anbumani N, Kalyani J, et al. Prevalence and antimicrobial susceptibility pattern of Coagulase-negative Staphylococcus. International Journal of Medicine and Public Health. 2011;1(4):59‒62.
  27. Azih A, Enabulele I. Species distribution and virulence factors of coagulase           negative Staphylococci isolated from clinical samples from the University of Benin Teaching hospital, Edo State, Nigeria. Journal of Natural Sciences Research. 2013;3(9):38‒43.
  28. Chaves F, García-Álvarez M, Sanz F, et al. Nosocomial spread of a Staphylococcus hominis subsp. novobiosepticus strain causing sepsis in a neonatal intensive care unit. Journal of Clinical Microbiology. 2005;43(9):4877‒4879.
  29. Roy P, Ahmed NH, Biswal I, et al. Multidrug-resistant Staphylococcus hominis subsp. novobiosepticus causing septicemia in patients with malignancy. Indian Journal of Pathology and Microbiology. 2014;57(2):275‒277.
  30. Tevell S, Hellmark B, Nilsdotter-Augustinsson Å, et al. Staphylococcus capitis isolated from prosthetic joint infections. European Journal of Clinical Microbiology & Infectious Diseases. 2017;36(1):115‒122.
  31. Cone LA, Sontz EM, Wilson JW, et al. Staphylococcus capitis endocarditis due to a transvenous endocardial pacemaker infection: case report and review of Staphylococcus capitis endocarditis. International Journal of Infectious Diseases. 2005;9(6):335‒359.
  32. Zaidel E, Di Toro Da, Kazelián L, et al. Staphylococcus Capitis Endocarditis: Living with S. Capitis. Journal of Innovations in Cardiac Rhythm Management. 2012;3:982‒985.
  33. Basaglia G, Moras L, Bearz A, et al. Staphylococcus cohnii septicaemia in a patient with colon cancer. Journal of Medical Microbiology. 2003;52(Pt 1):101‒102.
  34. Soldera J, Nedel WL, Cardoso PR, et al. Bacteremia due to Staphylococcus cohnii ssp. urealyticus caused by infected pressure ulcer: case report and review of the literature. Sao Paulo Medical Journal. 2013;131(1):59‒61.
  35. Bagcigil FA, Moodley A, Baptiste KE, et al. Occurrence, species distribution, antimicrobial resistance and clonality of methicillin-and erythromycin-resistant staphylococci in the nasal cavity of domestic animals. Veterinary Microbiology. 2007;121(3-4):307‒315.
  36. Singh S, Dhawan B, Kapil A, et al. Coagulase-negative staphylococci causing blood stream infection at an Indian tertiary      care hospital: prevalence, antimicrobial resistance and molecular characterisation. Indian Journal of Medical Microbiology. 2016;34(4):500‒505.
  37. Ma XX, Wang EH, Liu Y, et al. Antibiotic susceptibility of coagulase-negative staphylococci (CoNS): emergence of teicoplanin-non-susceptible CoNS strains with inducible resistance to vancomycin. Journal of Medical Microbiology. 2011;60(11):1661‒1668.
  38. Rahman ZA, Hamzah SH, Asma'Hassan S, et al. The significance of coagulase-negative staphylococci bacteremia in a low resource setting. The Journal of Infection in Developing Countries. 2013;7(6):448‒452.
  39. Hussain Z, Stoakes L, John MA, et al. Detection of methicillin resistance in primary blood culture isolates of coagulase-negative staphylococci by PCR, slide agglutination, disk diffusion, and a commercial method. Journal of Clinical Microbiology. 2002;40(6):2251‒2253.
  40. Akpaka PE, Christian N, Bodonaik NC, et al. Epidemiology of coagulase-negative staphylococci isolated from clinical blood specimens at the University Hospital of the West Indies. West Indian Medical Journal. 2006;55(3):170‒173.
  41. Fokas S, Tsironi M, Kalkani M, et al. Prevalence of inducible clindamycin resistance in macrolide‐resistant Staphylococcus spp. Clinical Microbiology and Infection. 2005;11(4):337‒340.
  42. Duran N, Ozer B, Duran GG, et al. Antibiotic resistance genes & susceptibility patterns in staphylococci. The Indian Journal of Medical Research. 2012;135(3):389‒396.
  43. Ahmed R, Singh S, Farooq U, et al. Occurrence and Antimicrobial Susceptibility Pattern of Methicillin-resistant Staphylococcus aureus and Methicillin-resistant Coagulase-Negative Staphylococci Isolated from Different Clinical Specimens from the Patients Hospitalized. International Journal of Scientific Study. 2016;3(11):41‒47.
  44. Murugesan S, Perumal N, Mahalingam SP, et al. Analysis of antibiotic resistance genes and its associated SCCmec types among nasal carriage of methicillin resistant coagulase negative staphylococci from community settings, Chennai, Southern India. Journal of clinical and diagnostic research. 2015;9(8):DC01‒DC05.
  45. Howden BP, Grayson ML. Dumb and dumber-the potential waste of a useful antistaphylococcal agent: emerging fusidic acid resistance in Staphylococcus aureus. Clinical Infectious Diseases. 2006;42(3):394‒400.
  46. Castanheira M, Watters AA, Mendes RE, et al. Occurrence and molecular characterization of fusidic acid resistance mechanisms among Staphylococcus spp. from European countries (2008). Journal of antimicrobial chemotherapy. 2010;65(7):1353‒1358.
  47. Bhatt P, Tandel K, Singh A, et al. Species distribution and antimicrobial resistance pattern of Coagulase-negative Staphylococci at a tertiary care centre. Medical Journal Armed Forces India. 2016;72(1):71‒74.
  48. Al Tayyar IA, Al-Zoubi MS, Hussein E, et al. Prevalence and antimicrobial susceptibility pattern of coagulase-negative staphylococci (CoNS) isolated from clinical specimens in Northern of Jordan. Iranian Journal of Microbiology. 2015;7(6):294‒301.
  49. Desai IM, Bhavsar HK, Darji SM, et al. Bacteriological analysis including antimicrobial susceptibility pattern of blood stream infections in tertiary care hospital. Annals of Pathology and Laboratory Medicine. 2017;4(3):A332‒337.
  50. Geisinger E, Isberg RR. Interplay between antibiotic resistance and virulence         during disease promoted by multidrug-resistant bacteria. The Journal of Infectious Diseases. 2017;215(Suppl1):S9‒S17.
  51. Garza-González E, López D, Pezina C, et al. Diversity of staphylococcal cassette chromosome mec       structures in coagulase-negative staphylococci and relationship to drug resistance. Journal of Medical Microbiology. 2010;59(3):323‒329.
  52. Mert G, Kiliç A, Bedir O, et al. Clinical significance and staphylococcal cassette chromosome mec (SCCmec) characterization of coagulase-negative staphylococci isolated from blood cultures. Turkish Journal of Medical Sciences. 2011;41(5):859‒865.
  53. Sani NA, Sapri HF, Neoh HM, et al. First report on the molecular epidemiology of Malaysian Staphylococcus epidermidis isolated from a University Teaching Hospital. BMC research notes. 2014;7(1):597.
  54. Chen XP, Li WG, Zheng H, et al. Extreme diversity and multiple SCC mec elements in coagulase-negative Staphylococcus found in the Clinic and Community in Beijing, China. Annals of Clinical Microbiology and Antimicrobials. 2017;16(1):57.
  55. Wisplinghoff H, Rosato AE, Enright MC, et al. Related clones containing SCCmec type IV predominate among clinically significant                 Staphylococcus epidermidis isolates. Antimicrobial agents and chemotherapy. 2003;47(11):3574‒3579.
  56. Ibrahem S, Salmenlinna S, Virolainen A, et al. Carriage of methicillin-resistant staphylococci and their SCCmec types in a long-term-care facility. Journal of Clinical Microbiology. 2009;47(1):32‒37.
  57. Machado AB, Reiter KC, Paiva RM, et al. Distribution of staphylococcal cassette chromosome mec (SCCmec) types I, II, III and IV in coagulase-negative staphylococci from patients attending a tertiary hospital in southern Brazil. Journal of Medical Microbiology. 2007;56(10):1328‒1333.
  58. Xu Z, Li L, Alam MJ, et al. First confirmation of integron-bearing methicillin-resistant Staphylococcus aureus. Current Microbiology. 2008;57(3):264‒268.
  59. Mitsan O, Oladeinde B. Staphylococcal cassette chromosome mec (sccmec)           typing of methicillin-resistant staphylococci obtained from clinical samples In South-South, Nigeria. World Journal of Pharmacy & Pharmaceutical Sciences. 2016;5(7):91‒103.
  60. Rachman AR, Suhaili Z, Desa MN. The evolution and dissemination of methicillin resistance determinant in Staphylococcus aureus. In: The Rise of Virulence and Antibiotic Resistance in Staphylococcus aureus; 2017.
  61. Deurenberg RH, Vink C, Kalenic S, et al. The molecular evolution of methicillin-resistant Staphylococcus aureus. Clinical Microbiology and Infection. 2007;13(3):222‒235.
  62. Jamaluddin TZ, Kuwahara-Arai K, Hisata K, et al. Extreme genetic diversity of methicillin-resistant Staphylococcus epidermidis strains disseminated among healthy Japanese children. Journal of Clinical Microbiology. 2008;46(11):3778‒3783.
  63. Barbier F, Ruppé E, Hernandez D, et al. Methicillin-resistant coagulase-negative staphylococci in the community: high homology of SCCmec IVa between Staphylococcus epidermidis and major clones of methicillin-resistant Staphylococcus aureus. The Journal of infectious diseases. 2010;202(2):270‒281.
  64. Ruppé E, Barbier F, Mesli Y, et al. Diversity of staphylococcal cassette chromosome mec structures in methicillin-resistant Staphylococcus epidermidis and Staphylococcus haemolyticus strains among outpatients from four countries. Antimicrobial Agents and Chemotherapy. 2009;53(2):442‒449.
  65. Venkatesh MP, Placencia F, Weisman LE. Coagulase-negative staphylococcal infections in the neonate and child: an update. In Seminars in pediatric infectious diseases. 2006;17(3):120‒127.
  66. Hanssen AM, Ericson Sollid JU. SCCmec in staphylococci: genes on the move. FEMS Immunology & Medical Microbiology. 2006;46(1):8‒20.
Creative Commons Attribution License

©2022 Saber, et al. This is an open access article distributed under the terms of the, which permits unrestricted use, distribution, and build upon your work non-commercially.