Background: Hepatitis C Virus (HCV) infection is a global public health problem and a leading cause for liver cirrhosis and hepatocellular carcinoma. HCV is a single-stranded RNA virus of the Flaviviridae family with 11 genotypes and 67 subtypes. Viral genotypes/viral loads determine potential response, duration and outcome of therapy. This study aimed to determine biochemical aberrations and HCV viral load/genotypic patterns among Sudanese patients with chronic HCV infection.
Methods: Following informed consent, four hundreds and seventy-three patients with ELISA reactivity to HCV were enrolled. Patients with chronic alcohol consumption, Hepatitis B virus or HIV co-infections were excluded. Plasma was collected for Albumin, Globulin, Alkaline phosphatase, AST/ALT levels, bilirubin and HCV viral load/genotypes determination using commercial kits/chemistry analyzer/qPCR machine. Briefly: Total RNA extraction, reverse transcription to cDNA on RNA template using sequence specific primers,a positive control for standard curve construction and Internal Control to rule out possible false negative results, to monitor analysis steps and to reveal the effect of PCR inhibitors.
Results: Patients’ mean age was 32.4±10.3 years and a Male: Female ratio of 2.5. Mean serum albumin [3.9±0.67grams/dL] and globulin [3.1±0.7grams/dL] levels were within normal range. While alkaline phosphatase [164.0±112.2IU/L; p<0.01], ALT [70.2±194 U/L; p<0.01], AST [88.3±237U/L; p<0.01], total bilirubin [2.1±3.5 mg/dl; p<0.01] and direct bilirubin [1.2±2.3mg/dL; p<0.01] were significantly elevated. HCV viral loads of 100 to 919IU/mL [Median 358IU/mL] were detected. Genotype 4a was detected in the majority of patients (92.6%; 437/473), while genotypes 2a and 2b were reported in a minority (3.7%, 18/473 each). HCV genotypes 4a and 2a/2b had similar ALT/AST/bilirubin levels and baseline viral loads.
Conclusion: HCV genotype 4 was the most common genotype in Sudan, while genotypes 2a and 2b were seen in a minority. There were no significant correlations between HCV genotypes and serum ALT/AST levels/baseline HCV viral loads.
Keywords: hepatitis C virus, genotype, biochemical aberrations, anti-HCV antibodies, genotype 4, Viral load
ALT, alanine aminotransferase; AST, aspartate aminotransferase; DNA, deoxyribonucleic acid; ELISA, enzyme-linked immunosorbent assay; HBV, hepatitis B virus; HCV, hepatitis C virus; HIV, human immunodeficiency virus; MGB, minor groove binder; PBS, phosphate buffer saline; PCR, polymerase chain reaction; SD, standard deviation; WHO, world health organization
Hepatitis C virus infection is a global public health problem and a leading cause of acute and chronic liver disease. HCV is a small, single-stranded RNA virus of the Flaviviridae family that can infect hepatocytes, lymphocytes and monocytes. It is classified into eleven genotypes and 67 subtypes on genetic differences. Hepatitis C infections can be concentrated in certain populations and/or in general populations.1–4 HCV is transmitted through needle sharing, contaminated surgical equipment, blood transfusion, sexual contact and from infected mothers to babies. Variable low to high prevalence (1.3%-55%) of HCV in patients with hepatocellular carcinoma or chronic liver disease have been reported form different African countries.5–7 The global prevalence of anti-HCV has been estimated at 2.0% (1.7–2.3%) among adults and 1.6% (1.3–2.1%) for all ages with an estimated 115 million people infected mainly adults. HCV infection is not preventable by vaccination, so improved surveillance and access to screening and treatment at national and regional levels are strongly recommended.8–14 Sudan is the largest country in the Nile valley with a land mass about the size of Europe with HCV infection prevalence among asymptomatic male Sudanese blood donors of 1.5%-4.4%. This is definitely an under-estimate since females do not usually donate blood in Sudan. The highest prevalence [66.7%] of HCV infection in Sudan was noted in patients with end-stage renal disease on regular hemodialysis.2,15 Early diagnosis and treatment of HCV infection minimize risks of both long-term complications and transmission of infection. HCV infection is usually diagnosed by the detection of anti-HCV antibodies in a patient’s serum that react to recombinant HCV proteins in ELISA or chemiluminescence immunoassays.16,17 However, various biochemical and molecular markers are now available that can be used in screening for hepatitis C infection, for both diagnosis and monitoring chronic HCV infection. Alanine aminotransferase (ALT) and aspartate aminotransferase (AST) are routinely employed for the initial assessment and monitoring of hepatic disease.7,16–20
It is well-documented that viral loads and viral genotypes determine potential response, duration and outcome of therapy. There are multiple genotypes of the HCV and their distribution varies by region. To date there are eleven HCV genotypes with 67 subtypes [a, b, c] based on differences in sequence of the HCV genome. Each genotype differs from the others by 30%-35% of its nucleotide site sequence and existing as numerous genetically distinct isolates.1–8,21–23 Genotypes 1-3 are widely distributed globally, with genotypes 1a and 1b accounting for 60% of infections worldwide. Genotype 1 accounts for 46% of all anti-HCV infections among adults in general populations, followed by genotype 3 (22%), genotype 2 (13%), genotype 4 (13%), genotype 6 (2%) and genotype 5 (1%). Although genotypes 4 and 5 are almost exclusive to Africa, genotypes 1 and 3 have been reported in parts of the content. Genotype 4 is characteristic for the Middle East, Egypt and Central Africa. Previous studies from Sudan showed that genotype 4 is the most frequently isolated genotype among HCV patients.2,24–27 Although HCV genotype 4 is the cause of approximately 20% of the 170 million cases of chronic hepatitis C in the world, it has not been the subject of widespread research with no established management strategies compared to genotypes 1, 2 and 3.7,28–31 This study aimed to determine biochemical aberrations and HCV viral load/genotypic patterns among Sudanese patients with chronic HCV infection.
This was a prospective, cross-sectional and analytical study that was approved by the Ethics and Scientific Committees of the Institute of Endemic Disease, University of Khartoum, Sudan. Individual informed consents were secured form all participating individuals. Patients on anti-viral treatment, with chronic alcohol consumption and those co-infected hepatitis B virus HIV were excluded. The tests were carried out at Elzahrawi Medical Laboratories, Khartoum, Sudan.
Blood samplesSera and EDTA-bloods were collected for biochemical and viral studies.
Biochemical markersPlasma albumin, globulin, alkaline phosphatase, ALT, AST, total bilirubin, direct/indirect bilirubins and total proteins were estimated using an Automate biochemistry analyzer (Biosystem BTS310, Biosystem, Barcelona, Spain).
ELISA test for anti-HCV antibodies detectionAnti-HCV antibodies were detected using an ELISA commercial kit (Koma Biotech International, Seoul, Korea), following the manufacturer's instructions and using the EZ Read 800 Microplate Reader (Biochrom Ltd, Cambridge, UK).
Molecular detection and quantification [viral load] of HCV by qPCR33,34
Molecular detection and quantification of HCV were done using One step commercial kits [Genesig, Primerdesign, UK] with the following primers and probes (FW: 5´AGCGTCTAGCCATGGCGTT3´ RV: 5´GCAAGCACCCTATCAGGCAGT3´ Probe: FAM 5´TCTGCGGAACCGGTGAGT3´ MGB NFQ.FAM as a reporter dye was attached to the 5´ end of the primer, a non-fluorescent quencher (NFQ) and minor groove binder (MGB) were attached to the 3´ end of the primer. The expected amplicon size was 238bp. To determine samples viral loads, a standard curve was constructed from serial dilutions of the positive control [cloned plasmids containing inserts in the conserved region of HCV virus] in an initial concentration of 4.9 × 109IU/mL and total of eight points in each curve. For HCV genotypes detection and determination in qPCR, pathogen genome specific region is amplified using specific primers. The amplified product was detected with the use of fluorescent dyes that are linked to oligonucleotide probes, which bind specifically to the amplified product during thermo-cycling. Briefly: HCV genotype detection included: total RNA extraction. Reverse transcription of cDNA on RNA template using sequence specific qPCR. Detection of HCV genotypes in a single clinical sample was carried out in several tubes. Either two HCV genotypes or HCV genotype and IC can be discriminated in one tube during the run. The kit used “hot-start”, which greatly reduced the frequency of non-specifically primed reactions. Negative controls were included in all reactions to test kit stability, while internal controls were used to rule out possible false negative results, monitor all stages of the analysis and to reveal the effect of PCR inhibitors. The reactions were performed in Spectrum48qPCRmachine (ESCO Micro Pte. Ltd. Singapore).
Statistical analysis
Study data was entered in Microsoft Excel and exported for further statistical analysis in the shareware Epi Info version 7. Standard descriptive statistical analysis and correlations between variables [using t Test] was carried out as per biochemical parameters and HCV viral load. P-value ˂0.05 was considered significant.
Four hundreds and seventy-three positive HCV patients by ELISA and molecular technique had a mean age of 32.4±10.3 years [range 7-67; median 32.0; mode 34 years] and a Male: Female ratio of 2.5.
Biochemical aberrations among HCV patients
Mean plasma Albumin and globulins levels were within normal range [3.9±0.67 and 3.1grams/dL respectively]. Alkaline phosphates levels were significantly higher in HCV samples [164.0±112.2IU/L] compared to normal range [NR up to 140IU/L, p<0.01]. ALT and AST levels were significantly higher in the HCV patients compared to normal range [70.2 ± 194IU/L vs NR19.0± 7.7IU/L, p<0.01] and [88.3±237IU/L vs NR18.3±4.2IU/L, p<0.01] respectively. Total bilirubin levels were significantly higher in the HCV patients [2.1±3.5mg/dl [NR up to 1.1mg/dL, p<0.01]. Direct Bilirubin levels were significantly higher in the HCV patients [1.2±2.3mg/dl, NR up to 0.3mg/dL, p<0.01]. Indirect Bilirubin levels were significantly higher in the HCV patients [0.9±1.3mg/dl, NR 0.8mg/dL, p<0.01].
Quantification of HCV viral loads
HCV viral load range of 100 to 919IU/mL [Median 358IU/mL] was detected in the study patients.
HCV genotypes among study patients [n=473]
Genotype 4a was detected in majority [92.6%, 438/473] of patients, while genotype 2 [2a and 2b] was reported in a minority of patients [3.7%, 18/473equal for 2a and 2b).
The highest prevalence of genotype 4a in Sudan has been previously reported from the Nile delta of Egypt, Libya and Central Africa, while genotype 2 (2a and 2b) is universally distributed. Lack of association between HCV genotypes and viral load in our study is in agreement with previous studies, but is different from Indian studies that showed a significant correlation between higher HCV viral load and genotype 1 as compared to other genotypes. A special note had to be made that almost all our patients have genotype 4a. The significantly high ALT/AST levels seen in our HCV patients with genotype 4 have been previously reported. The predominance of Genotype 4a in among our patients did not allow accurate association studies of viral loads and HCV viral genotypes.20,35–40
In conclusion, HCV genotype 4a was the most common genotype in Sudan, while genotypes 2a and 2b were seen in a minority. Most patients with HCV showed bilirubin and liver enzymes abnormalities.
The help of the staff of the Department of Clinical Pathology and Immunology, Institute of Endemic Diseases and the staff of the Elzahrawi Medical Laboratory, Khartoum, Sudan is highly appreciated.
All authors conceived the idea did the experimental work, the laboratory, data analysis and also prepared and approved the manuscript.
None
This study was supported by Department of Clinical Pathology and Immunology, Institute of Endemic Diseases.
The authors declare that they have no competing interests.
© . This is an open access article distributed under the terms of the, which permits unrestricted use, distribution, and build upon your work non-commercially.